Transcript: Human NM_021105.3

Homo sapiens phospholipid scramblase 1 (PLSCR1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PLSCR1 (5359)
Length:
1976
CDS:
155..1111

Additional Resources:

NCBI RefSeq record:
NM_021105.3
NBCI Gene record:
PLSCR1 (5359)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021105.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056268 CCGGAAACAAACTTGCCAGTT pLKO.1 191 CDS 100% 4.050 5.670 N PLSCR1 n/a
2 TRCN0000056272 CCACCTGGATTAGAATATTTA pLKO.1 440 CDS 100% 15.000 10.500 N PLSCR1 n/a
3 TRCN0000303438 GGCATTTACAGACGCTGATAA pLKO_005 961 CDS 100% 13.200 9.240 N PLSCR1 n/a
4 TRCN0000303437 ATTATGATCTCTGATTCATTG pLKO_005 1370 3UTR 100% 10.800 7.560 N PLSCR1 n/a
5 TRCN0000056271 CAGTTCCCTTTAGACCTTGAT pLKO.1 992 CDS 100% 4.950 3.465 N PLSCR1 n/a
6 TRCN0000299123 CAGTTCCCTTTAGACCTTGAT pLKO_005 992 CDS 100% 4.950 3.465 N PLSCR1 n/a
7 TRCN0000056269 CCAGTGTATAATCAGCCAGTA pLKO.1 353 CDS 100% 4.050 2.835 N PLSCR1 n/a
8 TRCN0000056270 CGGAAGATACTGATTGCTGTA pLKO.1 582 CDS 100% 4.050 2.835 N PLSCR1 n/a
9 TRCN0000303436 CAGGAGTGTGGTAGTGGATTA pLKO_005 1098 CDS 100% 10.800 6.480 N PLSCR1 n/a
10 TRCN0000303435 GTACCAATAGGTTATGTTATT pLKO_005 755 CDS 100% 0.000 0.000 N PLSCR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021105.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06741 pDONR223 100% 99.8% 99.6% None 947G>T n/a
2 ccsbBroad304_06741 pLX_304 0% 99.8% 99.6% V5 947G>T n/a
3 TRCN0000468286 TGATGCTGGTGCTTGCACTTAGCC pLX_317 39% 99.8% 99.6% V5 947G>T n/a
4 ccsbBroadEn_11034 pDONR223 100% 37.3% 33.6% None (many diffs) n/a
5 ccsbBroad304_11034 pLX_304 0% 37.3% 33.6% V5 (many diffs) n/a
6 TRCN0000478696 TACGTCGACAGGACTCTGAACAAA pLX_317 81.6% 37.3% 33.6% V5 (many diffs) n/a
Download CSV