Transcript: Mouse NM_021551.4

Mus musculus solute carrier family 22 (organic cation transporter), member 17 (Slc22a17), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc22a17 (59049)
Length:
2294
CDS:
745..1950

Additional Resources:

NCBI RefSeq record:
NM_021551.4
NBCI Gene record:
Slc22a17 (59049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021551.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070277 CCAACTTTATTGCCCATGCCA pLKO.1 1328 CDS 100% 0.750 1.050 N Slc22a17 n/a
2 TRCN0000070275 GCGATTTCTACAGCGAATGAT pLKO.1 1026 CDS 100% 5.625 3.938 N Slc22a17 n/a
3 TRCN0000038228 CCTCCTCAACTACCGCAACAT pLKO.1 1278 CDS 100% 4.950 3.465 N SLC22A17 n/a
4 TRCN0000070276 CCTCTGTATCCTCAGCATCAT pLKO.1 1785 CDS 100% 4.950 3.465 N Slc22a17 n/a
5 TRCN0000038227 CTGATAGTGAAGCGGCAGATT pLKO.1 1114 CDS 100% 4.950 3.465 N SLC22A17 n/a
6 TRCN0000070273 GAAAGATAGACAGGAAGGCAA pLKO.1 2005 3UTR 100% 2.640 1.848 N Slc22a17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021551.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08274 pDONR223 100% 68.3% 72.3% None (many diffs) n/a
2 ccsbBroad304_08274 pLX_304 0% 68.3% 72.3% V5 (many diffs) n/a
3 TRCN0000473865 GCCAGAACTCAAGTATCTTCGGCA pLX_317 29.1% 68.3% 72.3% V5 (many diffs) n/a
Download CSV