Transcript: Human NM_022098.4

Homo sapiens X-prolyl aminopeptidase 3 (XPNPEP3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
XPNPEP3 (63929)
Length:
7938
CDS:
35..1558

Additional Resources:

NCBI RefSeq record:
NM_022098.4
NBCI Gene record:
XPNPEP3 (63929)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022098.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424112 GCTGGTGGTAATCGGTCAAAC pLKO_005 947 CDS 100% 10.800 15.120 N XPNPEP3 n/a
2 TRCN0000412747 GTAACTCCTCCCTACCTATTC pLKO_005 2057 3UTR 100% 10.800 15.120 N XPNPEP3 n/a
3 TRCN0000031962 GAGACGAACATGGTTTGGTAT pLKO.1 626 CDS 100% 4.950 6.930 N Xpnpep3 n/a
4 TRCN0000428069 ACTTCGCAGACACAAACTAAT pLKO_005 253 CDS 100% 13.200 10.560 N XPNPEP3 n/a
5 TRCN0000073930 CCTGGGATGGTAATCACAATT pLKO.1 1364 CDS 100% 13.200 10.560 N XPNPEP3 n/a
6 TRCN0000427143 GAAACCATGTTCACCAGTAAA pLKO_005 836 CDS 100% 13.200 9.240 N XPNPEP3 n/a
7 TRCN0000073928 GCATTCCAGTTAACACATTTA pLKO.1 1860 3UTR 100% 13.200 9.240 N XPNPEP3 n/a
8 TRCN0000413106 AGATCCCAGTCGAGAACTTTG pLKO_005 502 CDS 100% 10.800 7.560 N XPNPEP3 n/a
9 TRCN0000073932 AGGACTATCTCAGGTGGAATA pLKO.1 229 CDS 100% 10.800 7.560 N XPNPEP3 n/a
10 TRCN0000419111 GAGATCCAAAGAGATTGTTTG pLKO_005 1130 CDS 100% 10.800 7.560 N XPNPEP3 n/a
11 TRCN0000073931 CCCTGATAGGACAGAAGCTTA pLKO.1 1203 CDS 100% 4.950 3.465 N XPNPEP3 n/a
12 TRCN0000073929 CCCTACATACTACATGAGCAA pLKO.1 340 CDS 100% 2.640 1.848 N XPNPEP3 n/a
13 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 3584 3UTR 100% 10.800 5.400 Y MRPS16 n/a
14 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2334 3UTR 100% 4.950 2.475 Y ERAP2 n/a
15 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 6156 3UTR 100% 4.950 2.475 Y n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2335 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 3584 3UTR 100% 10.800 5.400 Y CD3EAP n/a
18 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5509 3UTR 100% 5.625 2.813 Y KLHL30 n/a
19 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5509 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022098.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03908 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03908 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478758 TAGCGCCAACACCGTCGGCAAATT pLX_317 23.4% 100% 100% V5 n/a
Download CSV