Transcript: Human NM_022101.4

Homo sapiens chromosome X open reading frame 56 (CXorf56), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CXorf56 (63932)
Length:
2301
CDS:
55..723

Additional Resources:

NCBI RefSeq record:
NM_022101.4
NBCI Gene record:
CXorf56 (63932)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022101.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420298 CATAGACGGATTCCTATTTAT pLKO_005 794 3UTR 100% 15.000 10.500 N CXorf56 n/a
2 TRCN0000430877 GGCAAAGTAATTTCTTGATTA pLKO_005 773 3UTR 100% 13.200 9.240 N CXorf56 n/a
3 TRCN0000414248 TACGTTGTTTCCCATTGATTC pLKO_005 832 3UTR 100% 10.800 6.480 N CXorf56 n/a
4 TRCN0000168073 CGTGTCTACCATTGATGAAGA pLKO.1 528 CDS 100% 4.950 2.970 N CXorf56 n/a
5 TRCN0000168623 GCATTTAGATCAGGAGGCAAA pLKO.1 758 3UTR 100% 4.050 2.430 N CXorf56 n/a
6 TRCN0000167919 CCTGTTACCTTCATTGTGGAT pLKO.1 382 CDS 100% 2.640 1.584 N CXorf56 n/a
7 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1812 3UTR 100% 4.950 2.475 Y ORAI2 n/a
8 TRCN0000167207 CTTGATTGACAACCAGTTCAA pLKO.1 699 CDS 100% 4.950 2.475 Y CXorf56 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1158 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1809 3UTR 100% 4.950 2.475 Y LOC339059 n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1902 3UTR 100% 10.800 5.400 Y SMIM11A n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1158 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022101.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08818 pDONR223 100% 99.8% 100% None 375C>T n/a
2 ccsbBroad304_08818 pLX_304 0% 99.8% 100% V5 375C>T n/a
3 TRCN0000480783 GGCGCCCTCACTTTTCACATATCA pLX_317 59.9% 99.8% 100% V5 375C>T n/a
Download CSV