Transcript: Mouse NM_023585.4

Mus musculus ubiquitin-conjugating enzyme E2 variant 2 (Ube2v2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ube2v2 (70620)
Length:
5892
CDS:
44..481

Additional Resources:

NCBI RefSeq record:
NM_023585.4
NBCI Gene record:
Ube2v2 (70620)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023585.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040914 CGTCTTATGATGTCCAAAGAA pLKO.1 413 CDS 100% 5.625 7.875 N Ube2v2 n/a
2 TRCN0000316949 CGTCTTATGATGTCCAAAGAA pLKO_005 413 CDS 100% 5.625 7.875 N Ube2v2 n/a
3 TRCN0000305460 GACGTACAACAACTAACTTTA pLKO_005 466 CDS 100% 13.200 10.560 N Ube2v2 n/a
4 TRCN0000040913 CCCTCAAAGATGTTCTAAATA pLKO.1 2688 3UTR 100% 15.000 10.500 N Ube2v2 n/a
5 TRCN0000040916 CGCTTGTTGGAAGAACTTGAA pLKO.1 83 CDS 100% 4.950 3.465 N Ube2v2 n/a
6 TRCN0000349339 CGCTTGTTGGAAGAACTTGAA pLKO_005 83 CDS 100% 4.950 3.465 N Ube2v2 n/a
7 TRCN0000305459 GAAGGACAGACGTACAACAAC pLKO_005 458 CDS 100% 4.950 3.465 N Ube2v2 n/a
8 TRCN0000040917 GCATGATTATTGGGCCACCAA pLKO.1 186 CDS 100% 2.640 1.848 N Ube2v2 n/a
9 TRCN0000040915 GCCTGAAAGTAGAATGTGGAT pLKO.1 234 CDS 100% 2.640 1.848 N Ube2v2 n/a
10 TRCN0000004034 CAAGGTGGACAGGCATGATTA pLKO.1 174 CDS 100% 13.200 7.920 N UBE2V2 n/a
11 TRCN0000273330 CAAGGTGGACAGGCATGATTA pLKO_005 174 CDS 100% 13.200 7.920 N UBE2V2 n/a
12 TRCN0000305519 GTAGAATGTGGATCTAAATAC pLKO_005 242 CDS 100% 13.200 7.920 N Ube2v2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023585.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01742 pDONR223 100% 95.1% 98.6% None (many diffs) n/a
2 ccsbBroad304_01742 pLX_304 0% 95.1% 98.6% V5 (many diffs) n/a
3 TRCN0000474497 GGCACAGCCACCCTAATTTTCGTC pLX_317 87.6% 95.1% 98.6% V5 (many diffs) n/a
4 ccsbBroadEn_01741 pDONR223 100% 81.6% 87.7% None (many diffs) n/a
5 ccsbBroad304_01741 pLX_304 0% 81.6% 87.7% V5 (many diffs) n/a
6 TRCN0000468843 CTGAGCTAAAGGCTACTCTTGCGC pLX_317 82.6% 81.6% 87.7% V5 (many diffs) n/a
Download CSV