Transcript: Mouse NM_023587.2

Mus musculus 3-hydroxyacyl-CoA dehydratase 2 (Hacd2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Hacd2 (70757)
Length:
3603
CDS:
61..825

Additional Resources:

NCBI RefSeq record:
NM_023587.2
NBCI Gene record:
Hacd2 (70757)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023587.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030087 CCATCAGCTTACCTAACAAAT pLKO.1 662 CDS 100% 13.200 18.480 N Hacd2 n/a
2 TRCN0000030086 GCGTACCTGGTCATCTACAAT pLKO.1 178 CDS 100% 5.625 7.875 N Hacd2 n/a
3 TRCN0000030088 GCTACCATAGCCTTTATTATT pLKO.1 266 CDS 100% 15.000 10.500 N Hacd2 n/a
4 TRCN0000030085 CCTGACTTCTTTCCAGGTGAT pLKO.1 375 CDS 100% 4.050 2.835 N Hacd2 n/a
5 TRCN0000159607 GTCTATTAAACCATCTGCCTT pLKO.1 524 CDS 100% 2.640 1.848 N HACD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023587.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05198 pDONR223 100% 90.1% 94.8% None (many diffs) n/a
2 ccsbBroad304_05198 pLX_304 0% 90.1% 94.8% V5 (many diffs) n/a
3 TRCN0000466043 TCTCGACATAGAGGAGGGGCTGAC pLX_317 47.3% 90.1% 94.8% V5 (many diffs) n/a
Download CSV