Transcript: Mouse NM_023733.3

Mus musculus carnitine O-octanoyltransferase (Crot), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Crot (74114)
Length:
2803
CDS:
161..1999

Additional Resources:

NCBI RefSeq record:
NM_023733.3
NBCI Gene record:
Crot (74114)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023733.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110569 CGATGCAATGGTCATGGTGAA pLKO.1 1150 CDS 100% 4.050 5.670 N Crot n/a
2 TRCN0000325522 CGATGCAATGGTCATGGTGAA pLKO_005 1150 CDS 100% 4.050 5.670 N Crot n/a
3 TRCN0000110566 CCTGCACTTGAAGAATCATTA pLKO.1 236 CDS 100% 13.200 9.240 N Crot n/a
4 TRCN0000325521 CCTGCACTTGAAGAATCATTA pLKO_005 236 CDS 100% 13.200 9.240 N Crot n/a
5 TRCN0000110565 GCCTCAACAAAGCAAATCTAT pLKO.1 2203 3UTR 100% 5.625 3.938 N Crot n/a
6 TRCN0000325525 GCCTCAACAAAGCAAATCTAT pLKO_005 2203 3UTR 100% 5.625 3.938 N Crot n/a
7 TRCN0000110567 GCGTTTGTCTTTGATGTACTA pLKO.1 758 CDS 100% 4.950 3.465 N Crot n/a
8 TRCN0000325523 GCGTTTGTCTTTGATGTACTA pLKO_005 758 CDS 100% 4.950 3.465 N Crot n/a
9 TRCN0000110568 CCACGATATGATACAGCTGAT pLKO.1 1960 CDS 100% 4.050 2.835 N Crot n/a
10 TRCN0000325524 CCACGATATGATACAGCTGAT pLKO_005 1960 CDS 100% 4.050 2.835 N Crot n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023733.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10240 pDONR223 100% 12.4% 11.5% None (many diffs) n/a
2 ccsbBroad304_10240 pLX_304 0% 12.4% 11.5% V5 (many diffs) n/a
3 TRCN0000466600 GACAATGAGAGATCCGTACAATTC pLX_317 100% 12.4% 11.5% V5 (many diffs) n/a
Download CSV