Transcript: Human NM_024344.1

Homo sapiens calpain 3 (CAPN3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
CAPN3 (825)
Length:
3298
CDS:
307..2754

Additional Resources:

NCBI RefSeq record:
NM_024344.1
NBCI Gene record:
CAPN3 (825)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024344.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003492 GATGGTAAGGAATATGGATAA pLKO.1 1173 CDS 100% 10.800 7.560 N CAPN3 n/a
2 TRCN0000419076 TGATGACTCGGAGGTGATTTG pLKO_005 1719 CDS 100% 10.800 7.560 N CAPN3 n/a
3 TRCN0000003493 CCGCAACTTCCCAGATACTTT pLKO.1 1647 CDS 100% 5.625 3.938 N CAPN3 n/a
4 TRCN0000003494 CGGAGTGAAAGAGAAGACATT pLKO.1 468 CDS 100% 4.950 3.465 N CAPN3 n/a
5 TRCN0000003496 CCACCTCAACAACCAGCTCTA pLKO.1 2556 CDS 100% 4.050 2.835 N CAPN3 n/a
6 TRCN0000003495 GCTCCTGCTTACCTTGCTCTA pLKO.1 3045 3UTR 100% 4.050 2.430 N CAPN3 n/a
7 TRCN0000030678 CCAAAGAGATGCACGGGAATA pLKO.1 1835 CDS 100% 10.800 8.640 N Capn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024344.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00215 pDONR223 100% 36.9% 36.9% None 1_1536del;1781_1782insGAAAAAGAAAAAAACCAA n/a
2 ccsbBroad304_00215 pLX_304 0% 36.9% 36.9% V5 1_1536del;1781_1782insGAAAAAGAAAAAAACCAA n/a
3 TRCN0000474090 TACAAGAACCAATTATGGAGAGAC pLX_317 57.3% 36.9% 36.9% V5 1_1536del;1781_1782insGAAAAAGAAAAAAACCAA n/a
4 ccsbBroadEn_00216 pDONR223 100% 19.1% 19.1% None 1_1977del n/a
5 ccsbBroad304_00216 pLX_304 0% 19.1% 19.1% V5 1_1977del n/a
6 TRCN0000470316 GCGTAGCCTTGGAGAACGACCAAC pLX_317 68.4% 19.1% 19.1% V5 1_1977del n/a
Download CSV