Transcript: Mouse NM_024438.4

Mus musculus dual specificity phosphatase 19 (Dusp19), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Dusp19 (68082)
Length:
1463
CDS:
171..833

Additional Resources:

NCBI RefSeq record:
NM_024438.4
NBCI Gene record:
Dusp19 (68082)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024438.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081192 GACCACGCTAACTGGAAAGAA pLKO.1 239 CDS 100% 5.625 7.875 N Dusp19 n/a
2 TRCN0000335654 GACCACGCTAACTGGAAAGAA pLKO_005 239 CDS 100% 5.625 7.875 N Dusp19 n/a
3 TRCN0000356163 ACCTGCAAGTTGGCGTTATTA pLKO_005 355 CDS 100% 15.000 10.500 N DUSP19 n/a
4 TRCN0000348576 ACCTTTGTCGCCCTGAATTAA pLKO_005 954 3UTR 100% 15.000 10.500 N Dusp19 n/a
5 TRCN0000081189 CCTCAGTGAGTTTACATATAA pLKO.1 485 CDS 100% 15.000 10.500 N Dusp19 n/a
6 TRCN0000335655 CCTCAGTGAGTTTACATATAA pLKO_005 485 CDS 100% 15.000 10.500 N Dusp19 n/a
7 TRCN0000081188 CGCCAAGAGTACCAGAATCAA pLKO.1 1298 3UTR 100% 5.625 3.938 N Dusp19 n/a
8 TRCN0000081190 GAAAGCATAAGGTGACTCATA pLKO.1 430 CDS 100% 4.950 3.465 N Dusp19 n/a
9 TRCN0000081191 TCTATACTGGATGTGCCTGAA pLKO.1 513 CDS 100% 4.050 2.835 N Dusp19 n/a
10 TRCN0000335735 TCTATACTGGATGTGCCTGAA pLKO_005 513 CDS 100% 4.050 2.835 N Dusp19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024438.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04960 pDONR223 100% 84.4% 80.9% None (many diffs) n/a
2 ccsbBroad304_04960 pLX_304 0% 84.4% 80.9% V5 (many diffs) n/a
3 TRCN0000469812 CGGAGCATGTTTCTCCCACCTGAT pLX_317 69.1% 84.4% 80.9% V5 (many diffs) n/a
4 TRCN0000488400 AAGTGTCATGGATGGAGCAAACGT pLX_317 50.8% 83.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV