Transcript: Mouse NM_024459.2

Mus musculus protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type I) (Ppp3r1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ppp3r1 (19058)
Length:
2829
CDS:
243..755

Additional Resources:

NCBI RefSeq record:
NM_024459.2
NBCI Gene record:
Ppp3r1 (19058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000280166 TACAATTTGCGCCAGGTATTA pLKO_005 1240 3UTR 100% 13.200 18.480 N Ppp3r1 n/a
2 TRCN0000012485 CGTATCTATGACATGGATAAA pLKO.1 531 CDS 100% 13.200 10.560 N Ppp3r1 n/a
3 TRCN0000280151 CGTATCTATGACATGGATAAA pLKO_005 531 CDS 100% 13.200 10.560 N Ppp3r1 n/a
4 TRCN0000012484 CCTTTAGTACAGCGGGTAATA pLKO.1 399 CDS 100% 13.200 9.240 N Ppp3r1 n/a
5 TRCN0000280152 CCTTTAGTACAGCGGGTAATA pLKO_005 399 CDS 100% 13.200 9.240 N Ppp3r1 n/a
6 TRCN0000012486 GTGGGCAACAATCTGAAAGAT pLKO.1 600 CDS 100% 5.625 3.938 N Ppp3r1 n/a
7 TRCN0000280150 GTGGGCAACAATCTGAAAGAT pLKO_005 600 CDS 100% 5.625 3.938 N Ppp3r1 n/a
8 TRCN0000002757 CAGATAAGGATGGAGATGGAA pLKO.1 661 CDS 100% 3.000 2.100 N PPP3R1 n/a
9 TRCN0000012487 GTGGACTTCAAAGAATTCATT pLKO.1 450 CDS 100% 0.000 0.000 N Ppp3r1 n/a
10 TRCN0000297351 GTGGACTTCAAAGAATTCATT pLKO_005 450 CDS 100% 0.000 0.000 N Ppp3r1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13927 pDONR223 100% 94.1% 2.3% None (many diffs) n/a
2 ccsbBroad304_13927 pLX_304 0% 94.1% 2.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471046 TGCGGCTCATGCCCGGTGATCATA pLX_317 70.1% 94.1% 2.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV