Transcript: Human NM_024628.5

Homo sapiens solute carrier family 12 member 8 (SLC12A8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
SLC12A8 (84561)
Length:
3510
CDS:
112..2256

Additional Resources:

NCBI RefSeq record:
NM_024628.5
NBCI Gene record:
SLC12A8 (84561)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024628.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042999 CCTACAAGATAGCTTCCTCTT pLKO.1 1611 CDS 100% 4.050 5.670 N SLC12A8 n/a
2 TRCN0000042998 GCCATGTATATCACCGGCTTT pLKO.1 514 CDS 100% 4.050 5.670 N SLC12A8 n/a
3 TRCN0000079287 CCCTACAAGATAGCTTCCTCT pLKO.1 1610 CDS 100% 2.640 3.696 N Slc12a8 n/a
4 TRCN0000043000 CGCAGGTGTCAAATGGATAAT pLKO.1 630 CDS 100% 13.200 9.240 N SLC12A8 n/a
5 TRCN0000428417 CCGCTGTCACTTTGGACAATG pLKO_005 2367 3UTR 100% 10.800 7.560 N SLC12A8 n/a
6 TRCN0000428600 GACTTTGTGGTGGGTTCTTTC pLKO_005 697 CDS 100% 10.800 7.560 N SLC12A8 n/a
7 TRCN0000043001 CCTTCTCATCATGTTTGTGAT pLKO.1 1926 CDS 100% 4.950 3.465 N SLC12A8 n/a
8 TRCN0000043002 CCAGAAAGTCAGAAGAGGAAA pLKO.1 1567 CDS 100% 4.950 2.970 N SLC12A8 n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2591 3UTR 100% 4.950 2.475 Y n/a
10 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 2659 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024628.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09202 pDONR223 100% 99.9% 99.8% None 1991G>A;1998T>C n/a
2 ccsbBroad304_09202 pLX_304 0% 99.9% 99.8% V5 (not translated due to frame shift) 1991G>A;1998T>C n/a
3 TRCN0000477159 AACCAGCCAACTTCCTATCCCACA pLX_317 20.3% 99.9% 99.8% V5 (not translated due to prior stop codon) 1991G>A;1998T>C n/a
4 ccsbBroadEn_12831 pDONR223 100% 43% 42.9% None 1_1218del;1991G>A;1998T>C n/a
5 ccsbBroad304_12831 pLX_304 0% 43% 42.9% V5 1_1218del;1991G>A;1998T>C n/a
6 TRCN0000470592 TAAGCCGGAGTGCAACAAAGGACT pLX_317 46.3% 43% 42.9% V5 1_1218del;1991G>A;1998T>C n/a
Download CSV