Transcript: Human NM_025065.7

Homo sapiens ribosome production factor 1 homolog (RPF1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RPF1 (80135)
Length:
1948
CDS:
17..1066

Additional Resources:

NCBI RefSeq record:
NM_025065.7
NBCI Gene record:
RPF1 (80135)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025065.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151572 GCTTTAGCATTTCGGAGATTA pLKO.1 168 CDS 100% 13.200 18.480 N RPF1 n/a
2 TRCN0000310077 GCTTTAGCATTTCGGAGATTA pLKO_005 168 CDS 100% 13.200 18.480 N RPF1 n/a
3 TRCN0000155208 GAGCAGTGTTCGTCTTCGTAA pLKO.1 685 CDS 100% 4.950 6.930 N RPF1 n/a
4 TRCN0000292199 GAGCAGTGTTCGTCTTCGTAA pLKO_005 685 CDS 100% 4.950 6.930 N RPF1 n/a
5 TRCN0000155651 CTTAATGTTCACGCGGTGGAA pLKO.1 208 CDS 100% 2.640 3.696 N RPF1 n/a
6 TRCN0000292198 CTTAATGTTCACGCGGTGGAA pLKO_005 208 CDS 100% 2.640 3.696 N RPF1 n/a
7 TRCN0000152982 GAACAGCTCTCCACAGTTATA pLKO.1 497 CDS 100% 13.200 9.240 N RPF1 n/a
8 TRCN0000154377 CAGATAGACCTCATGGGAGAA pLKO.1 462 CDS 100% 4.050 2.835 N RPF1 n/a
9 TRCN0000154061 CAACAAACAGACTTCTCCCAA pLKO.1 424 CDS 100% 2.640 1.848 N RPF1 n/a
10 TRCN0000292256 CAACAAACAGACTTCTCCCAA pLKO_005 424 CDS 100% 2.640 1.848 N RPF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025065.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09006 pDONR223 100% 99.9% 99.7% None 25A>G n/a
2 ccsbBroad304_09006 pLX_304 0% 99.9% 99.7% V5 25A>G n/a
3 TRCN0000473519 TGTGGTACTGAAATTACCGAAAAA pLX_317 40.1% 99.9% 99.7% V5 25A>G n/a
Download CSV