Transcript: Human NM_025151.5

Homo sapiens RAB11 family interacting protein 1 (RAB11FIP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
RAB11FIP1 (80223)
Length:
6283
CDS:
57..2006

Additional Resources:

NCBI RefSeq record:
NM_025151.5
NBCI Gene record:
RAB11FIP1 (80223)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025151.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122490 CCGCTCTAATGTCTGCATCAA pLKO.1 995 CDS 100% 4.950 6.930 N RAB11FIP1 n/a
2 TRCN0000144803 GATGATGAGTCTGTGGTTAAA pLKO.1 663 CDS 100% 13.200 9.240 N RAB11FIP1 n/a
3 TRCN0000145281 GAAATCCAAACCAGGAAAGAA pLKO.1 440 CDS 100% 5.625 3.938 N RAB11FIP1 n/a
4 TRCN0000352860 GAAATCCAAACCAGGAAAGAA pLKO_005 440 CDS 100% 5.625 3.938 N RAB11FIP1 n/a
5 TRCN0000144426 CATCAGTGAGAACTTGAACAA pLKO.1 1751 CDS 100% 4.950 3.465 N RAB11FIP1 n/a
6 TRCN0000141878 GCAACTGAACCAGGTCAACTT pLKO.1 908 CDS 100% 4.950 3.465 N RAB11FIP1 n/a
7 TRCN0000343418 GCAACTGAACCAGGTCAACTT pLKO_005 908 CDS 100% 4.950 3.465 N RAB11FIP1 n/a
8 TRCN0000144687 GAACTTGAACAATGAGGTCAT pLKO.1 1760 CDS 100% 4.050 2.835 N RAB11FIP1 n/a
9 TRCN0000343464 GAACTTGAACAATGAGGTCAT pLKO_005 1760 CDS 100% 4.050 2.835 N RAB11FIP1 n/a
10 TRCN0000142684 CTGGTCCTCAAACAGAAGGAA pLKO.1 1851 CDS 100% 3.000 2.100 N RAB11FIP1 n/a
11 TRCN0000343465 CTGGTCCTCAAACAGAAGGAA pLKO_005 1851 CDS 100% 3.000 2.100 N RAB11FIP1 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4274 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 3071 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 3071 3UTR 100% 4.050 2.025 Y ORAI2 n/a
15 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 3071 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3033 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3198 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025151.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04193 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04193 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477132 GGGAGGCTATGTCTCGTGCAAGGT pLX_317 21% 100% 100% V5 n/a
Download CSV