Transcript: Mouse NM_025494.3

Mus musculus ATPase, H+ transporting, lysosomal V1 subunit C1 (Atp6v1c1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Atp6v1c1 (66335)
Length:
2117
CDS:
213..1361

Additional Resources:

NCBI RefSeq record:
NM_025494.3
NBCI Gene record:
Atp6v1c1 (66335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025494.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101628 CCCTATGTGTATTACAAGATT pLKO.1 1314 CDS 100% 5.625 4.500 N Atp6v1c1 n/a
2 TRCN0000323753 CCCTATGTGTATTACAAGATT pLKO_005 1314 CDS 100% 5.625 4.500 N Atp6v1c1 n/a
3 TRCN0000101625 GCCGAATAAGAAGTCAGTGAA pLKO.1 1178 CDS 100% 4.950 3.960 N Atp6v1c1 n/a
4 TRCN0000323683 GCCGAATAAGAAGTCAGTGAA pLKO_005 1178 CDS 100% 4.950 3.960 N Atp6v1c1 n/a
5 TRCN0000101627 GCGACCACCAAGAACAATAAT pLKO.1 285 CDS 100% 15.000 10.500 N Atp6v1c1 n/a
6 TRCN0000353809 GCGACCACCAAGAACAATAAT pLKO_005 285 CDS 100% 15.000 10.500 N Atp6v1c1 n/a
7 TRCN0000101626 GCGGTGGCTTAAAGTGAATTT pLKO.1 1052 CDS 100% 13.200 9.240 N Atp6v1c1 n/a
8 TRCN0000101629 TCTGCATACAATAACCTGAAA pLKO.1 633 CDS 100% 4.950 3.465 N Atp6v1c1 n/a
9 TRCN0000323685 TCTGCATACAATAACCTGAAA pLKO_005 633 CDS 100% 4.950 3.465 N Atp6v1c1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025494.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487910 TGCAACTAGCCACCCCACGCAAGG pLX_317 26.8% 89.4% 98.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488949 TGGCGGGTCCATAGGTCCTAGTAC pLX_317 28% 89.3% 97.9% V5 (many diffs) n/a
3 ccsbBroadEn_00136 pDONR223 100% 89.3% 97.9% None (many diffs) n/a
4 ccsbBroad304_00136 pLX_304 0% 89.3% 97.9% V5 (not translated due to frame shift) (many diffs) n/a
5 TRCN0000472527 CCCAACTCTGTCTATTAACAGCGC pLX_317 40.5% 89.3% 97.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV