Transcript: Mouse NM_025509.3

Mus musculus oligosaccharyltransferase complex subunit (non-catalytic) (Ostc), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ostc (66357)
Length:
1081
CDS:
70..519

Additional Resources:

NCBI RefSeq record:
NM_025509.3
NBCI Gene record:
Ostc (66357)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025509.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277548 ACAGAGTAAACGGACAGTATA pLKO_005 299 CDS 100% 13.200 18.480 N Ostc n/a
2 TRCN0000190431 CCAGTGTACCAGCTATGTTAA pLKO.1 729 3UTR 100% 13.200 9.240 N Ostc n/a
3 TRCN0000277550 CCAGTGTACCAGCTATGTTAA pLKO_005 729 3UTR 100% 13.200 9.240 N Ostc n/a
4 TRCN0000202196 CCCGGATTTGCTCCTGTTAAT pLKO.1 546 3UTR 100% 13.200 9.240 N Ostc n/a
5 TRCN0000285968 CCCGGATTTGCTCCTGTTAAT pLKO_005 546 3UTR 100% 13.200 9.240 N Ostc n/a
6 TRCN0000277551 TCTTTACAATGGGAGGTTTAG pLKO_005 347 CDS 100% 10.800 7.560 N Ostc n/a
7 TRCN0000189951 GCATCAGAGACCAGTAGCTTT pLKO.1 270 CDS 100% 4.950 3.465 N Ostc n/a
8 TRCN0000277549 GCATCAGAGACCAGTAGCTTT pLKO_005 270 CDS 100% 4.950 3.465 N Ostc n/a
9 TRCN0000190292 CATACCGAAACTCAACAGGTT pLKO.1 402 CDS 100% 2.640 1.848 N Ostc n/a
10 TRCN0000135655 GTTTCATAATCCTGGACCGAT pLKO.1 368 CDS 100% 2.640 1.848 N OSTC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025509.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03865 pDONR223 100% 89.7% 99.3% None (many diffs) n/a
2 ccsbBroad304_03865 pLX_304 0% 89.7% 99.3% V5 (many diffs) n/a
3 TRCN0000466811 CACCATCTTCCTCTACTAGCAACA pLX_317 98.7% 89.7% 99.3% V5 (many diffs) n/a
4 ccsbBroadEn_10576 pDONR223 100% 68.2% 73.1% None (many diffs) n/a
5 ccsbBroad304_10576 pLX_304 0% 68.2% 73.1% V5 (many diffs) n/a
Download CSV