Transcript: Mouse NM_025526.4

Mus musculus iron-sulfur cluster assembly enzyme (Iscu), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Iscu (66383)
Length:
887
CDS:
17..523

Additional Resources:

NCBI RefSeq record:
NM_025526.4
NBCI Gene record:
Iscu (66383)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025526.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179267 GATCCCTTGACAAGACATCTA pLKO.1 168 CDS 100% 4.950 6.930 N Iscu n/a
2 TRCN0000184394 CGTCATGAAACTGCAGATCCA pLKO.1 232 CDS 100% 2.640 3.696 N Iscu n/a
3 TRCN0000328851 CGTCATGAAACTGCAGATCCA pLKO_005 232 CDS 100% 2.640 3.696 N Iscu n/a
4 TRCN0000328853 CAAGAAGGTTGTGGATCATTA pLKO_005 127 CDS 100% 13.200 9.240 N Iscu n/a
5 TRCN0000183918 CCTGGCTGACTACAAACTGAA pLKO.1 466 CDS 100% 4.950 3.465 N Iscu n/a
6 TRCN0000328794 CCTGGCTGACTACAAACTGAA pLKO_005 466 CDS 100% 4.950 3.465 N Iscu n/a
7 TRCN0000184703 CGTGTGTCCTTAGTGCAGTTA pLKO.1 665 3UTR 100% 4.950 3.465 N Iscu n/a
8 TRCN0000353442 CGTGTGTCCTTAGTGCAGTTA pLKO_005 665 3UTR 100% 4.950 3.465 N Iscu n/a
9 TRCN0000179682 GCTGACTACAAACTGAAGCAA pLKO.1 470 CDS 100% 3.000 2.100 N Iscu n/a
10 TRCN0000178886 CACAAGAAGGTTGTGGATCAT pLKO.1 125 CDS 100% 0.495 0.347 N Iscu n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025526.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14087 pDONR223 100% 88.1% 95.8% None (many diffs) n/a
2 ccsbBroad304_14087 pLX_304 0% 88.1% 95.8% V5 (many diffs) n/a
3 TRCN0000481175 CTTTATAGCATCCCGACGGTCCCT pLX_317 88.8% 88.1% 95.8% V5 (many diffs) n/a
4 ccsbBroadEn_15763 pDONR223 0% 87.7% 95.2% None (many diffs) n/a
5 ccsbBroad304_15763 pLX_304 0% 87.7% 95.2% V5 (many diffs) n/a
6 TRCN0000480283 AACCGTCATTTCTGCAGGACAAGA pLX_317 67.9% 87.7% 95.2% V5 (many diffs) n/a
Download CSV