Transcript: Mouse NM_025609.2

Mus musculus TGF-beta activated kinase 1/MAP3K7 binding protein 1 (Tab1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tab1 (66513)
Length:
3013
CDS:
3..1511

Additional Resources:

NCBI RefSeq record:
NM_025609.2
NBCI Gene record:
Tab1 (66513)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025609.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088799 GCGATGATTGACACCGAGTTT pLKO.1 933 CDS 100% 4.950 6.930 N Tab1 n/a
2 TRCN0000302376 GCGATGATTGACACCGAGTTT pLKO_005 933 CDS 100% 4.950 6.930 N Tab1 n/a
3 TRCN0000088801 GTTACAGGTTACACAGCTAAA pLKO.1 593 CDS 100% 10.800 8.640 N Tab1 n/a
4 TRCN0000302314 GTTACAGGTTACACAGCTAAA pLKO_005 593 CDS 100% 10.800 8.640 N Tab1 n/a
5 TRCN0000088798 GCCCTTCCATCAGGATTAAAT pLKO.1 2598 3UTR 100% 15.000 10.500 N Tab1 n/a
6 TRCN0000302338 GCCCTTCCATCAGGATTAAAT pLKO_005 2598 3UTR 100% 15.000 10.500 N Tab1 n/a
7 TRCN0000088802 GCTATCCATTGGGTGAAATGA pLKO.1 1099 CDS 100% 5.625 3.938 N Tab1 n/a
8 TRCN0000088800 CCTCAGTACCAGAAGATCCTT pLKO.1 438 CDS 100% 3.000 2.100 N Tab1 n/a
9 TRCN0000302315 CCTCAGTACCAGAAGATCCTT pLKO_005 438 CDS 100% 3.000 2.100 N Tab1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025609.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02441 pDONR223 100% 88.3% 97.2% None (many diffs) n/a
2 ccsbBroad304_02441 pLX_304 0% 88.3% 97.2% V5 (many diffs) n/a
3 TRCN0000468326 TTAGACCTTTGTACCCTGATGACT pLX_317 27.9% 88.3% 97.2% V5 (many diffs) n/a
4 TRCN0000488629 AGAATCTGATTGATCCGACAGTAC pLX_317 22.3% 88.3% 97.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV