Transcript: Mouse NM_026030.2

Mus musculus eukaryotic translation initiation factor 2, subunit 2 (beta) (Eif2s2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Eif2s2 (67204)
Length:
2513
CDS:
203..1198

Additional Resources:

NCBI RefSeq record:
NM_026030.2
NBCI Gene record:
Eif2s2 (67204)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026030.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295794 CTACAATAAAGTGTTCGTTAA pLKO_005 1524 3UTR 100% 10.800 15.120 N Eif2s2 n/a
2 TRCN0000096875 CCCGACTCTATTTCTTACAAT pLKO.1 1080 CDS 100% 5.625 7.875 N Eif2s2 n/a
3 TRCN0000288554 CCCGACTCTATTTCTTACAAT pLKO_005 1080 CDS 100% 5.625 7.875 N Eif2s2 n/a
4 TRCN0000096878 GACATTATGCTTGGCAACAAA pLKO.1 554 CDS 100% 5.625 7.875 N Eif2s2 n/a
5 TRCN0000096877 CGTCCGAGTAGGAACCAAGAA pLKO.1 823 CDS 100% 4.950 6.930 N Eif2s2 n/a
6 TRCN0000295793 TGAAGCTACATGGCTAGAATA pLKO_005 1658 3UTR 100% 13.200 10.560 N Eif2s2 n/a
7 TRCN0000295731 GAAAGAGTGGTTGGAACATAA pLKO_005 1694 3UTR 100% 13.200 9.240 N Eif2s2 n/a
8 TRCN0000074789 CCCAAACATCTCCTTGCATTT pLKO.1 893 CDS 100% 10.800 7.560 N EIF2S2 n/a
9 TRCN0000291998 CCCAAACATCTCCTTGCATTT pLKO_005 893 CDS 100% 10.800 7.560 N EIF2S2 n/a
10 TRCN0000074790 GCTCAGAAAGAGACTACACAT pLKO.1 702 CDS 100% 4.950 3.465 N EIF2S2 n/a
11 TRCN0000307920 GCTCAGAAAGAGACTACACAT pLKO_005 702 CDS 100% 4.950 3.465 N EIF2S2 n/a
12 TRCN0000096876 GCTTCTGATGACTTAGATGAT pLKO.1 398 CDS 100% 4.950 3.465 N Eif2s2 n/a
13 TRCN0000288555 GCTTCTGATGACTTAGATGAT pLKO_005 398 CDS 100% 4.950 3.465 N Eif2s2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026030.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02044 pDONR223 99.3% 92.1% 95.4% None (many diffs) n/a
2 ccsbBroad304_02044 pLX_304 0% 92.1% 95.4% V5 (many diffs) n/a
3 TRCN0000479232 ATACAGAGGGCACATACTCATCAC pLX_317 25.3% 92.1% 95.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_07327 pDONR223 100% 92% 95.1% None (many diffs) n/a
5 ccsbBroad304_07327 pLX_304 0% 92% 95.1% V5 (many diffs) n/a
6 TRCN0000469646 GATGCCTAGACCATACTGATACCA pLX_317 31.3% 92% 95.1% V5 (many diffs) n/a
7 ccsbBroadEn_15648 pDONR223 0% 59.9% 62.7% None (many diffs) n/a
8 ccsbBroad304_15648 pLX_304 0% 59.9% 62.7% V5 (many diffs) n/a
9 TRCN0000475405 TGGGATTCTTTATGCGCGAATGCC pLX_317 75.9% 59.9% 62.7% V5 (many diffs) n/a
Download CSV