Transcript: Mouse NM_026152.1

Mus musculus 4-hydroxy-2-oxoglutarate aldolase 1 (Hoga1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Hoga1 (67432)
Length:
1635
CDS:
68..1033

Additional Resources:

NCBI RefSeq record:
NM_026152.1
NBCI Gene record:
Hoga1 (67432)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120083 CGCTTGGATTTCAGCAACAAT pLKO.1 1001 CDS 100% 5.625 7.875 N Hoga1 n/a
2 TRCN0000120084 GCAGAGGTAGACTATGGGAAA pLKO.1 197 CDS 100% 4.050 5.670 N Hoga1 n/a
3 TRCN0000120085 GCACCCAAATATCATCGGCTT pLKO.1 613 CDS 100% 2.160 3.024 N Hoga1 n/a
4 TRCN0000120082 CCACTCCCTAAGCATTTATAT pLKO.1 1427 3UTR 100% 15.000 10.500 N Hoga1 n/a
5 TRCN0000120086 GCGCTTGGATTTCAGCAACAA pLKO.1 1000 CDS 100% 4.950 3.465 N Hoga1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09380 pDONR223 100% 85.4% 87.7% None (many diffs) n/a
2 ccsbBroad304_09380 pLX_304 0% 85.4% 87.7% V5 (many diffs) n/a
3 TRCN0000473037 CGAATACGAGCAAAGGAGGGCTTC pLX_317 47.3% 85.4% 87.7% V5 (many diffs) n/a
4 ccsbBroadEn_16074 pDONR223 0% 42% 42.5% None (many diffs) n/a
5 ccsbBroad304_16074 pLX_304 0% 42% 42.5% V5 (many diffs) n/a
6 TRCN0000492014 TTCCAAACCCATTACCTTCAACGA pLX_317 67.1% 42% 42.5% V5 (many diffs) n/a
Download CSV