Transcript: Mouse NM_026278.3

Mus musculus Lrp2 binding protein (Lrp2bp), mRNA.

Source:
NCBI, updated 2019-01-20
Taxon:
Mus musculus (mouse)
Gene:
Lrp2bp (67620)
Length:
3420
CDS:
221..1261

Additional Resources:

NCBI RefSeq record:
NM_026278.3
NBCI Gene record:
Lrp2bp (67620)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026278.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247323 TCTATTCTCATGAGCTATAAA pLKO_005 2466 3UTR 100% 15.000 21.000 N Lrp2bp n/a
2 TRCN0000198288 GCCAAGCACTACTACTCTAAA pLKO.1 1175 CDS 100% 13.200 18.480 N Lrp2bp n/a
3 TRCN0000247327 GCCAAGCACTACTACTCTAAA pLKO_005 1175 CDS 100% 13.200 18.480 N Lrp2bp n/a
4 TRCN0000247325 TCTAAGAGGCCAACTCTATTT pLKO_005 406 CDS 100% 13.200 18.480 N Lrp2bp n/a
5 TRCN0000247326 TGCCGTCTGAACCCTACATTG pLKO_005 1199 CDS 100% 10.800 15.120 N Lrp2bp n/a
6 TRCN0000178559 CTATGATGAAGTCCACGACAT pLKO.1 1030 CDS 100% 4.050 5.670 N Lrp2bp n/a
7 TRCN0000247324 TATTACCTCCACGCTAATTTG pLKO_005 323 CDS 100% 13.200 10.560 N Lrp2bp n/a
8 TRCN0000130453 GCAGATGAACTTCACTCCTTA pLKO.1 1220 CDS 100% 4.950 3.960 N LRP2BP n/a
9 TRCN0000177241 GCATTCTGTCAAAGAACTTAA pLKO.1 1270 3UTR 100% 13.200 9.240 N Lrp2bp n/a
10 TRCN0000215359 CATCATGAAAGACGAAGAATC pLKO.1 1153 CDS 100% 10.800 7.560 N Lrp2bp n/a
11 TRCN0000129927 GATGAACTTCACTCCTTACTT pLKO.1 1223 CDS 100% 5.625 3.938 N LRP2BP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026278.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08591 pDONR223 100% 82.3% 85.6% None (many diffs) n/a
2 ccsbBroad304_08591 pLX_304 0% 82.3% 85.6% V5 (many diffs) n/a
3 TRCN0000477984 GTGATGTAGACTGAACAACTAATA pLX_317 33.9% 82.3% 85.6% V5 (many diffs) n/a
Download CSV