Transcript: Mouse NM_026479.4

Mus musculus zinc finger, CCHC domain containing 10 (Zcchc10), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Zcchc10 (67966)
Length:
1257
CDS:
13..549

Additional Resources:

NCBI RefSeq record:
NM_026479.4
NBCI Gene record:
Zcchc10 (67966)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026479.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177890 CGGCCAGAAGTGTTAAATAAA pLKO.1 632 3UTR 100% 15.000 21.000 N Zcchc10 n/a
2 TRCN0000345784 CGGCCAGAAGTGTTAAATAAA pLKO_005 632 3UTR 100% 15.000 21.000 N Zcchc10 n/a
3 TRCN0000182550 GTACCTCTAGCAGTGACAGTT pLKO.1 281 CDS 100% 0.000 0.000 N Zcchc10 n/a
4 TRCN0000298086 GTACCTCTAGCAGTGACAGTT pLKO_005 281 CDS 100% 0.000 0.000 N Zcchc10 n/a
5 TRCN0000197717 GCCTTTGAAATGAATGCTTTA pLKO.1 1005 3UTR 100% 10.800 7.560 N Zcchc10 n/a
6 TRCN0000177555 CCAATAAGCAACATGTAAGAT pLKO.1 59 CDS 100% 5.625 3.938 N Zcchc10 n/a
7 TRCN0000181840 GATGAGCCACAGAAGAAGAAA pLKO.1 514 CDS 100% 5.625 3.938 N Zcchc10 n/a
8 TRCN0000197503 CATTGGACTTATGAATGCAAA pLKO.1 103 CDS 100% 4.950 3.465 N Zcchc10 n/a
9 TRCN0000181473 CTTCATCAGAGAGTGAGACAT pLKO.1 314 CDS 100% 4.950 3.465 N Zcchc10 n/a
10 TRCN0000292935 CTTCATCAGAGAGTGAGACAT pLKO_005 314 CDS 100% 4.950 3.465 N Zcchc10 n/a
11 TRCN0000133700 GCAACATGTAAGATGTCAGAA pLKO.1 66 CDS 100% 4.950 3.465 N ZCCHC10 n/a
12 TRCN0000351620 GCAACATGTAAGATGTCAGAA pLKO_005 66 CDS 100% 4.950 3.465 N ZCCHC10 n/a
13 TRCN0000198994 GCTGAAGCCAATAAGCAACAT pLKO.1 52 CDS 100% 4.950 3.465 N Zcchc10 n/a
14 TRCN0000198875 GCTTGGAATTTGGACATTGGA pLKO.1 89 CDS 100% 3.000 2.100 N Zcchc10 n/a
15 TRCN0000200128 CCAGTGAGTCTTCATCAGAGA pLKO.1 305 CDS 100% 2.640 1.848 N Zcchc10 n/a
16 TRCN0000181839 GAAAGTACCTACACAGACCTT pLKO.1 131 CDS 100% 2.640 1.848 N Zcchc10 n/a
17 TRCN0000292936 GAAAGTACCTACACAGACCTT pLKO_005 131 CDS 100% 2.640 1.848 N Zcchc10 n/a
18 TRCN0000181703 GAAGGAAAGCTGAAGCCAATA pLKO.1 44 CDS 100% 10.800 6.480 N Zcchc10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026479.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08413 pDONR223 100% 79.1% 83.3% None (many diffs) n/a
2 ccsbBroad304_08413 pLX_304 0% 79.1% 83.3% V5 (many diffs) n/a
3 TRCN0000491505 TGAATTGTCGCCCCCAGATACACC pLX_317 74.3% 79.1% 83.3% V5 (many diffs) n/a
4 ccsbBroadEn_12089 pDONR223 100% 70.6% 74.2% None (many diffs) n/a
5 ccsbBroad304_12089 pLX_304 0% 70.6% 74.2% V5 (many diffs) n/a
6 TRCN0000478645 GCGCTTACTCCTGTGCGCTGACCT pLX_317 64.2% 70.6% 74.2% V5 (many diffs) n/a
Download CSV