Transcript: Mouse NM_026840.3

Mus musculus platelet-derived growth factor receptor-like (Pdgfrl), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pdgfrl (68797)
Length:
1545
CDS:
139..1266

Additional Resources:

NCBI RefSeq record:
NM_026840.3
NBCI Gene record:
Pdgfrl (68797)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099919 GCAACTGTGCAATGGCTACAT pLKO.1 573 CDS 100% 4.950 6.930 N Pdgfrl n/a
2 TRCN0000099915 CAGACAGACATCCGAATTAAA pLKO.1 1366 3UTR 100% 15.000 10.500 N Pdgfrl n/a
3 TRCN0000099917 GTCATTATCGTGGAAGACTTT pLKO.1 1159 CDS 100% 4.950 3.465 N Pdgfrl n/a
4 TRCN0000099918 CTACATATGCACAGCTCAGAA pLKO.1 1200 CDS 100% 0.000 0.000 N Pdgfrl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06706 pDONR223 100% 84.1% 89.3% None (many diffs) n/a
2 ccsbBroad304_06706 pLX_304 0% 84.1% 89.3% V5 (many diffs) n/a
3 TRCN0000481574 ACTGCAGCTACAGCAGGAGCACAA pLX_317 40.7% 84.1% 89.3% V5 (many diffs) n/a
4 ccsbBroadEn_14735 pDONR223 0% 84.1% 89.3% None (many diffs) n/a
5 ccsbBroad304_14735 pLX_304 0% 84.1% 89.3% V5 (many diffs) n/a
6 TRCN0000475233 GTCACCCACCACTCCTAAGATCAC pLX_317 42% 84.1% 89.3% V5 (many diffs) n/a
7 TRCN0000488856 TTCTAATTCATGAGCTCAAAGTGG pLX_317 28.5% 84.1% 89.3% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488180 CATTGTGGTCATTCTCCTCATTTA pLX_317 26.5% 83.9% 89% V5 (many diffs) n/a
Download CSV