Transcript: Mouse NM_027032.2

Mus musculus PARK2 co-regulated (Pacrg), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pacrg (69310)
Length:
1355
CDS:
324..1049

Additional Resources:

NCBI RefSeq record:
NM_027032.2
NBCI Gene record:
Pacrg (69310)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201299 GCATGACTCGAAAGGAAACAA pLKO.1 533 CDS 100% 5.625 7.875 N Pacrg n/a
2 TRCN0000189879 CCTCCGAAACAGACAGATCAT pLKO.1 749 CDS 100% 4.950 3.465 N Pacrg n/a
3 TRCN0000191049 CCTGAACATCTTTAAGAACAT pLKO.1 863 CDS 100% 4.950 3.465 N Pacrg n/a
4 TRCN0000192399 CTGGAAGGTTGAGATTGAGAA pLKO.1 560 CDS 100% 4.950 3.465 N Pacrg n/a
5 TRCN0000129776 CTTAAACAAATGCCCAGACAA pLKO.1 302 5UTR 100% 4.950 3.465 N PACRG n/a
6 TRCN0000217411 GTCCTAGCATCTCATTACTTG pLKO.1 1104 3UTR 100% 4.950 3.465 N Pacrg n/a
7 TRCN0000189976 GATCATCTGTGTGACGCTCAA pLKO.1 764 CDS 100% 4.050 2.835 N Pacrg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04899 pDONR223 100% 83.2% 86.3% None (many diffs) n/a
2 ccsbBroad304_04899 pLX_304 0% 83.2% 86.3% V5 (many diffs) n/a
3 TRCN0000469772 GCCCGCTGGTAGACAACCTGAAAC pLX_317 58.7% 83.2% 86.3% V5 (many diffs) n/a
4 ccsbBroadEn_04898 pDONR223 100% 83.2% 86.3% None (many diffs) n/a
5 ccsbBroad304_04898 pLX_304 0% 83.2% 86.3% V5 (many diffs) n/a
6 TRCN0000470221 AAGGAGTTCCTCTCAACATAGACA pLX_317 58% 83.2% 86.3% V5 (many diffs) n/a
Download CSV