Transcript: Mouse NM_027181.1

Mus musculus protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) (Pin4), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Pin4 (69713)
Length:
478
CDS:
58..453

Additional Resources:

NCBI RefSeq record:
NM_027181.1
NBCI Gene record:
Pin4 (69713)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027181.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346210 TGAAGTGGCCACACAATATAG pLKO_005 252 CDS 100% 13.200 6.600 Y Pin4 n/a
2 TRCN0000346211 AGAAGTCTCAGGGTCCTAAAG pLKO_005 134 CDS 100% 10.800 5.400 Y Pin4 n/a
3 TRCN0000353246 CAGTAAAGGTCAGACACATTC pLKO_005 167 CDS 100% 10.800 5.400 Y Pin4 n/a
4 TRCN0000049220 GCCTGTAAGTGGGATGGATAA pLKO.1 360 CDS 100% 10.800 5.400 Y PIN4 n/a
5 TRCN0000252599 GCCTGTAAGTGGGATGGATAA pLKO_005 360 CDS 100% 10.800 5.400 Y Pin4 n/a
6 TRCN0000327792 GCCTGTAAGTGGGATGGATAA pLKO_005 360 CDS 100% 10.800 5.400 Y PIN4 n/a
7 TRCN0000346213 TTAAAGTCTGGGATGAGATTC pLKO_005 229 CDS 100% 10.800 5.400 Y Pin4 n/a
8 TRCN0000049219 GCAGTAAAGGTCAGACACATT pLKO.1 166 CDS 100% 4.950 2.475 Y PIN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027181.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000471417 TATTTTCACACTCGAGTTCGACGA pLX_317 100% 94.6% 96.9% V5 (many diffs) n/a
2 ccsbBroadEn_15529 pDONR223 0% 94.4% 96.9% None (many diffs) n/a
3 ccsbBroad304_15529 pLX_304 0% 94.4% 96.9% V5 (many diffs) n/a
4 ccsbBroadEn_06729 pDONR223 100% 79.2% 81.4% None (many diffs) n/a
5 TRCN0000477942 TGTGTCAAGTAATCTTTCTAGAGG pLX_317 55.8% 79.2% 81.4% V5 (many diffs) n/a
Download CSV