Transcript: Mouse NM_027563.4

Mus musculus keratin 34 (Krt34), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Krt34 (16672)
Length:
1609
CDS:
59..1237

Additional Resources:

NCBI RefSeq record:
NM_027563.4
NBCI Gene record:
Krt34 (16672)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027563.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422100 GATGTCGATGAAGTCATTTAG pLKO_005 1259 3UTR 100% 13.200 18.480 N Krt34 n/a
2 TRCN0000428547 TTTCCGTTGTCACTAAGAAAC pLKO_005 1325 3UTR 100% 10.800 15.120 N Krt34 n/a
3 TRCN0000089801 CAGCTCAAAGCGTTGCTGTTA pLKO.1 1216 CDS 100% 4.950 3.465 N Krt34 n/a
4 TRCN0000089798 GCTTTCCTGAACCAGCAACTT pLKO.1 1382 3UTR 100% 4.950 3.465 N Krt34 n/a
5 TRCN0000089799 CCACCAATGCTAGTGGCAGTT pLKO.1 1179 CDS 100% 4.050 2.835 N Krt34 n/a
6 TRCN0000089800 AGCAGAAGATTCTGTGTGCTA pLKO.1 399 CDS 100% 2.640 1.848 N Krt34 n/a
7 TRCN0000433330 AGTACCAGACTGAGCTGTCCA pLKO_005 489 CDS 100% 2.640 1.848 N Krt34 n/a
8 TRCN0000116830 CCACCACCAATGCTAGTGGCA pLKO.1 1176 CDS 100% 0.220 0.132 N KRT34 n/a
9 TRCN0000089802 CATGAGAAACTCTCTGGAGAA pLKO.1 931 CDS 100% 4.050 2.025 Y Krt34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027563.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00921 pDONR223 100% 83.7% 84.4% None (many diffs) n/a
2 ccsbBroad304_00921 pLX_304 0% 83.7% 84.4% V5 (many diffs) n/a
3 ccsbBroadEn_00920 pDONR223 100% 80.7% 83.4% None (many diffs) n/a
4 ccsbBroad304_00920 pLX_304 0% 80.7% 83.4% V5 (many diffs) n/a
5 TRCN0000467714 ATTAGCGGGGACGAAACGTTTAGA pLX_317 35% 80.7% 83.4% V5 (many diffs) n/a
6 ccsbBroadEn_06510 pDONR223 100% 79% 79.1% None (many diffs) n/a
7 ccsbBroad304_06510 pLX_304 0% 79% 79.1% V5 (many diffs) n/a
8 TRCN0000477279 GGCACAGACCCCCTATCAGTTGAG pLX_317 24% 79% 79.1% V5 (many diffs) n/a
Download CSV