Transcript: Mouse NM_028072.5

Mus musculus sulfatase 2 (Sulf2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sulf2 (72043)
Length:
3790
CDS:
274..2901

Additional Resources:

NCBI RefSeq record:
NM_028072.5
NBCI Gene record:
Sulf2 (72043)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028072.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253275 TCAGACTACTCCACGGATTAC pLKO_005 826 CDS 100% 10.800 15.120 N Sulf2 n/a
2 TRCN0000180519 GACGGGAAGTCTATTCTCAAA pLKO.1 1417 CDS 100% 4.950 6.930 N Sulf2 n/a
3 TRCN0000253274 TGGTGCTTGAGGACCATAAAT pLKO_005 2560 CDS 100% 15.000 10.500 N Sulf2 n/a
4 TRCN0000253272 GGACGCTGAAGCTGCACAAAT pLKO_005 1682 CDS 100% 13.200 9.240 N Sulf2 n/a
5 TRCN0000265360 TCGAGGTGGACGGTGAGATAT pLKO_005 1913 CDS 100% 13.200 9.240 N Sulf2 n/a
6 TRCN0000181100 CGCCGTAAGCTCTTTAAGAAA pLKO.1 1843 CDS 100% 5.625 3.938 N Sulf2 n/a
7 TRCN0000051986 CCACAACACCTACACCAACAA pLKO.1 582 CDS 100% 4.950 3.465 N SULF2 n/a
8 TRCN0000195853 CGGTGCTACATCCTTGAGAAT pLKO.1 2092 CDS 100% 4.950 3.465 N Sulf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028072.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03686 pDONR223 100% 87.3% 93.7% None (many diffs) n/a
2 ccsbBroad304_03686 pLX_304 0% 87.3% 93.7% V5 (many diffs) n/a
3 TRCN0000467260 CAGACTTTGACATACCAAACCATC pLX_317 16.4% 87.2% 93.7% V5 (many diffs) n/a
4 TRCN0000488599 CCAAATTTATCCGAGAAATGGTGT pLX_317 12.1% 87.1% 93.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489588 ATCCCTCAGCTGGGAGTTGTGTCC pLX_317 15.2% 85.2% 91.4% V5 (many diffs) n/a
6 TRCN0000487852 TTCTTAGCTTGATTTAGTGCCCTA pLX_317 12.8% 85% 91.5% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_12292 pDONR223 100% 15.3% 16.3% None (many diffs) n/a
8 ccsbBroad304_12292 pLX_304 0% 15.3% 16.3% V5 (many diffs) n/a
9 TRCN0000473719 ACACTCACATTATGGGGCCACTAC pLX_317 77.7% 15.3% 16.3% V5 (many diffs) n/a
Download CSV