Transcript: Mouse NM_028142.4

Mus musculus NOL1/NOP2/Sun domain family, member 4 (Nsun4), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Nsun4 (72181)
Length:
3526
CDS:
101..1246

Additional Resources:

NCBI RefSeq record:
NM_028142.4
NBCI Gene record:
Nsun4 (72181)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028142.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097371 GCGGAGATATCGATATAAGAA pLKO.1 166 CDS 100% 5.625 7.875 N Nsun4 n/a
2 TRCN0000309584 GCGGAGATATCGATATAAGAA pLKO_005 166 CDS 100% 5.625 7.875 N Nsun4 n/a
3 TRCN0000097373 GTCACGTTGTCTATTCAACTT pLKO.1 999 CDS 100% 4.950 6.930 N Nsun4 n/a
4 TRCN0000309649 GTCACGTTGTCTATTCAACTT pLKO_005 999 CDS 100% 4.950 6.930 N Nsun4 n/a
5 TRCN0000097369 GCCCATAGTTTAAGCTGTAAA pLKO.1 1482 3UTR 100% 13.200 9.240 N Nsun4 n/a
6 TRCN0000309647 GCCCATAGTTTAAGCTGTAAA pLKO_005 1482 3UTR 100% 13.200 9.240 N Nsun4 n/a
7 TRCN0000097370 GCTGGTAATACCAAACCTCAT pLKO.1 1177 CDS 100% 4.050 2.835 N Nsun4 n/a
8 TRCN0000160972 GCTGGTAATACCAAACCTCAT pLKO.1 1177 CDS 100% 4.050 2.835 N NSUN4 n/a
9 TRCN0000309585 GCTGGTAATACCAAACCTCAT pLKO_005 1177 CDS 100% 4.050 2.835 N Nsun4 n/a
10 TRCN0000097372 GACACCTATGATAGGGTGTTA pLKO.1 830 CDS 100% 0.495 0.347 N Nsun4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028142.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10083 pDONR223 100% 85.9% 85.1% None (many diffs) n/a
2 ccsbBroad304_10083 pLX_304 0% 85.9% 85.1% V5 (many diffs) n/a
3 TRCN0000478407 GCACAAGCCTGAAGCTTCGCTAGC pLX_317 29.7% 85.9% 85.1% V5 (many diffs) n/a
Download CSV