Transcript: Mouse NM_028372.1

Mus musculus metallo-beta-lactamase domain containing 2 (Mblac2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Mblac2 (72852)
Length:
3881
CDS:
113..952

Additional Resources:

NCBI RefSeq record:
NM_028372.1
NBCI Gene record:
Mblac2 (72852)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028372.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267889 TATTCCTTGCGACCGTATAAA pLKO_005 2731 3UTR 100% 15.000 21.000 N Mblac2 n/a
2 TRCN0000267948 TTGCAGGATTGCGGGTCTAAA pLKO_005 299 CDS 100% 13.200 18.480 N Mblac2 n/a
3 TRCN0000189666 CAAGAACGGTTCTACGAGTCA pLKO.1 170 CDS 100% 2.640 3.696 N Mblac2 n/a
4 TRCN0000420275 TATGATGGATCACTGATTGAC pLKO_005 686 CDS 100% 4.950 3.960 N MBLAC2 n/a
5 TRCN0000200747 GCTTACATGATAAAGACCGTA pLKO.1 639 CDS 100% 2.640 2.112 N Mblac2 n/a
6 TRCN0000202163 CGACAGACAGCTCACTGTTAT pLKO.1 586 CDS 100% 13.200 9.240 N Mblac2 n/a
7 TRCN0000215714 CTCAACGTAAACTAGCATTTA pLKO.1 1426 3UTR 100% 13.200 9.240 N Mblac2 n/a
8 TRCN0000267891 TAGTATCTACACTGGTCATTT pLKO_005 950 CDS 100% 13.200 9.240 N Mblac2 n/a
9 TRCN0000267946 TTCGCTTAGCTTCTAACTATA pLKO_005 834 CDS 100% 13.200 9.240 N Mblac2 n/a
10 TRCN0000137612 CCTGGGCACTTCAATACCTTT pLKO.1 797 CDS 100% 4.950 3.465 N MBLAC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028372.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05071 pDONR223 100% 91.7% 97.1% None (many diffs) n/a
2 ccsbBroad304_05071 pLX_304 0% 91.7% 97.1% V5 (many diffs) n/a
3 TRCN0000470121 AATATGATCATTAAAACATAGTCT pLX_317 62.8% 91.7% 97.1% V5 (many diffs) n/a
Download CSV