Transcript: Mouse NM_028806.2

Mus musculus phosphatase and actin regulator 3 (Phactr3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Phactr3 (74189)
Length:
5100
CDS:
453..2129

Additional Resources:

NCBI RefSeq record:
NM_028806.2
NBCI Gene record:
Phactr3 (74189)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028806.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431962 TGATACCAACACTGAACATTC pLKO_005 2165 3UTR 100% 10.800 7.560 N PHACTR3 n/a
2 TRCN0000174447 CCTGAAACAAAGGAATGATCA pLKO.1 1826 CDS 100% 4.950 3.465 N Phactr3 n/a
3 TRCN0000174289 CAGGAAATGAATAAAGGCTTT pLKO.1 2670 3UTR 100% 4.050 2.835 N Phactr3 n/a
4 TRCN0000193633 CCTAGAAGGAACTTACTGGAA pLKO.1 2899 3UTR 100% 2.640 1.848 N Phactr3 n/a
5 TRCN0000176214 GAGGAACTGGAGAGAAGAAAT pLKO.1 1803 CDS 100% 13.200 7.920 N Phactr3 n/a
6 TRCN0000052691 GCAGCAGATAAGGCAGCAATT pLKO.1 2025 CDS 100% 10.800 6.480 N PHACTR3 n/a
7 TRCN0000425136 GACCCACTGTTGATGAATTAA pLKO_005 1906 CDS 100% 15.000 10.500 N PHACTR3 n/a
8 TRCN0000052688 GCTGTGTTTGTGAGAAGAGTA pLKO.1 2213 3UTR 100% 4.950 3.465 N PHACTR3 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3782 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028806.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04697 pDONR223 100% 86.7% 88.7% None (many diffs) n/a
2 ccsbBroad304_04697 pLX_304 0% 86.7% 88.7% V5 (many diffs) n/a
3 TRCN0000470159 CACGTGACTTTCCAAGATCCGTTG pLX_317 20.6% 86.7% 88.7% V5 (many diffs) n/a
Download CSV