Transcript: Mouse NM_028871.2

Mus musculus heterogeneous nuclear ribonucleoprotein R (Hnrnpr), transcript variant 1, mRNA.

Source:
NCBI, updated 2015-12-25
Taxon:
Mus musculus (mouse)
Gene:
Hnrnpr (74326)
Length:
8025
CDS:
161..2059

Additional Resources:

NCBI RefSeq record:
NM_028871.2
NBCI Gene record:
Hnrnpr (74326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112076 GCACTGCGTATGAAGATTATT pLKO.1 1443 CDS 100% 15.000 21.000 N Hnrnpr n/a
2 TRCN0000308980 GCACTGCGTATGAAGATTATT pLKO_005 1443 CDS 100% 15.000 21.000 N Hnrnpr n/a
3 TRCN0000112075 GCGTAACTGTTTCATCTTTAA pLKO.1 2132 3UTR 100% 13.200 18.480 N Hnrnpr n/a
4 TRCN0000308978 GCGTAACTGTTTCATCTTTAA pLKO_005 2132 3UTR 100% 13.200 18.480 N Hnrnpr n/a
5 TRCN0000001241 GACGTTATTCTCTATCATCAA pLKO.1 983 CDS 100% 4.950 6.930 N HNRNPR n/a
6 TRCN0000293488 GACGTTATTCTCTATCATCAA pLKO_005 983 CDS 100% 4.950 6.930 N HNRNPR n/a
7 TRCN0000112077 CGATGCTCTCAGGGAGTTTAA pLKO.1 355 CDS 100% 13.200 9.240 N Hnrnpr n/a
8 TRCN0000308981 CGATGCTCTCAGGGAGTTTAA pLKO_005 355 CDS 100% 13.200 9.240 N Hnrnpr n/a
9 TRCN0000235504 GAGGGTTTGGTGGACGTTATT pLKO_005 971 CDS 100% 13.200 9.240 N HNRNPR n/a
10 TRCN0000112079 CAAGAGGTAGAGCTGGCTATT pLKO.1 1725 CDS 100% 10.800 7.560 N Hnrnpr n/a
11 TRCN0000331893 CAAGAGGTAGAGCTGGCTATT pLKO_005 1725 CDS 100% 10.800 7.560 N Hnrnpr n/a
12 TRCN0000001240 GAACACTACAAGACACTGATA pLKO.1 242 CDS 100% 4.950 3.465 N HNRNPR n/a
13 TRCN0000112078 GAAGATCCCTACTACGGCTAT pLKO.1 1616 CDS 100% 4.050 2.835 N Hnrnpr n/a
14 TRCN0000308914 GAAGATCCCTACTACGGCTAT pLKO_005 1616 CDS 100% 4.050 2.835 N Hnrnpr n/a
15 TRCN0000001238 CTCTTGGACATTATTGGGCTT pLKO.1 2241 3UTR 100% 2.160 1.512 N HNRNPR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02365 pDONR223 100% 93.5% 99% None (many diffs) n/a
2 ccsbBroad304_02365 pLX_304 0% 93.5% 99% V5 (many diffs) n/a
3 TRCN0000466686 CACGCCATCGCACTAAAGTCCACA pLX_317 17% 93.5% 99% V5 (many diffs) n/a
Download CSV