Transcript: Mouse NM_029441.3

Mus musculus chromodomain protein, Y chromosome-like 2 (Cdyl2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cdyl2 (75796)
Length:
8087
CDS:
171..1682

Additional Resources:

NCBI RefSeq record:
NM_029441.3
NBCI Gene record:
Cdyl2 (75796)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248228 CCCATCGTGGTAGCCATTAAT pLKO_005 1203 CDS 100% 15.000 21.000 N Cdyl2 n/a
2 TRCN0000215492 GATTTACAAACCCAGATATTG pLKO.1 2261 3UTR 100% 13.200 18.480 N Cdyl2 n/a
3 TRCN0000247397 TAATACCCAACTGAGTGATTT pLKO_005 2245 3UTR 100% 13.200 18.480 N Cdyl2 n/a
4 TRCN0000247395 TCTGCAGCGGACTAGACTATT pLKO_005 1081 CDS 100% 13.200 18.480 N Cdyl2 n/a
5 TRCN0000173551 GAATGAAAGCAACTGTCGGTT pLKO.1 887 CDS 100% 2.640 2.112 N Cdyl2 n/a
6 TRCN0000248227 CCTGCACTGTGAGGAGTTTAT pLKO_005 305 CDS 100% 13.200 9.240 N Cdyl2 n/a
7 TRCN0000216993 CTTAGGGCTTGGTCTTAATAC pLKO.1 2230 3UTR 100% 13.200 9.240 N Cdyl2 n/a
8 TRCN0000215684 GGGAAATGGGAATATCTTATC pLKO.1 231 CDS 100% 10.800 7.560 N Cdyl2 n/a
9 TRCN0000129423 CGCCAGAATGAAAGCAACTGT pLKO.1 882 CDS 100% 3.000 2.100 N CDYL2 n/a
10 TRCN0000247396 GTCCAGCCAGACTTCGGATAA pLKO_005 956 CDS 100% 10.800 6.480 N Cdyl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04781 pDONR223 100% 85.3% 91.5% None (many diffs) n/a
2 ccsbBroad304_04781 pLX_304 0% 85.3% 91.5% V5 (many diffs) n/a
3 TRCN0000476109 GCTGGTTGAAGATTCTCGGGCAGT pLX_317 22.5% 85.3% 91.5% V5 (many diffs) n/a
Download CSV