Transcript: Mouse NM_029478.3

Mus musculus vacuole membrane protein 1 (Vmp1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Vmp1 (75909)
Length:
2773
CDS:
110..1330

Additional Resources:

NCBI RefSeq record:
NM_029478.3
NBCI Gene record:
Vmp1 (75909)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279103 CCCTATCCTGACCAGATTATC pLKO_005 590 CDS 100% 13.200 18.480 N Vmp1 n/a
2 TRCN0000279038 CGCTTGTAGCTACGTATTATG pLKO_005 372 CDS 100% 13.200 18.480 N Vmp1 n/a
3 TRCN0000174322 CCTGTCTATTATTAACTCCAT pLKO.1 1249 CDS 100% 2.640 2.112 N Vmp1 n/a
4 TRCN0000279036 CCTGTCTATTATTAACTCCAT pLKO_005 1249 CDS 100% 2.640 2.112 N Vmp1 n/a
5 TRCN0000173693 CCTTGTACCTTTCTGGACCTT pLKO.1 952 CDS 100% 2.640 2.112 N Vmp1 n/a
6 TRCN0000279037 CCTTGTACCTTTCTGGACCTT pLKO_005 952 CDS 100% 2.640 2.112 N Vmp1 n/a
7 TRCN0000297615 ATGTTACACTGACATACTTTA pLKO_005 1469 3UTR 100% 13.200 9.240 N Vmp1 n/a
8 TRCN0000193479 GCTTGTCACAAATGATTGTTT pLKO.1 1651 3UTR 100% 5.625 3.938 N Vmp1 n/a
9 TRCN0000175594 CCAGAGATGTTTGCTTTGCTT pLKO.1 2401 3UTR 100% 3.000 2.100 N Vmp1 n/a
10 TRCN0000216520 GATTGGGAAAGCAATCATTAA pLKO.1 988 CDS 100% 1.320 0.924 N Vmp1 n/a
11 TRCN0000175370 CGGATAGCTTATCAGACTGAT pLKO.1 2493 3UTR 100% 4.950 2.475 Y Vmp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14292 pDONR223 100% 90.9% 93.3% None (many diffs) n/a
2 ccsbBroad304_14292 pLX_304 0% 90.9% 93.3% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000472825 TAACTTTTCGTTTCAACGCGCCAG pLX_317 36.9% 90.9% 93.3% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV