Transcript: Mouse NM_029999.4

Mus musculus limb-bud and heart (Lbh), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lbh (77889)
Length:
3068
CDS:
249..566

Additional Resources:

NCBI RefSeq record:
NM_029999.4
NBCI Gene record:
Lbh (77889)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029999.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095612 CTATCTGAGATCGGCTGAGAT pLKO.1 281 CDS 100% 4.950 6.930 N Lbh n/a
2 TRCN0000442472 GTGAGCAAATGAGCAAGAAAG pLKO_005 948 3UTR 100% 10.800 7.560 N Lbh n/a
3 TRCN0000095613 CGCAAGGATGGCCTTTCCTAT pLKO.1 354 CDS 100% 4.950 3.465 N Lbh n/a
4 TRCN0000095611 GATGAGCAAGACAACTGTGAA pLKO.1 516 CDS 100% 4.950 3.465 N Lbh n/a
5 TRCN0000095610 GCTCCATCCATGGAAGAGATT pLKO.1 321 CDS 100% 4.950 3.465 N Lbh n/a
6 TRCN0000095609 CCTTGTAGAATAGCAGCCTTT pLKO.1 1852 3UTR 100% 4.050 2.835 N Lbh n/a
7 TRCN0000454067 GGTGATGATGAACGCTCCATC pLKO_005 308 CDS 100% 4.050 2.835 N Lbh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029999.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04245 pDONR223 100% 89.5% 90.4% None (many diffs) n/a
2 ccsbBroad304_04245 pLX_304 0% 89.5% 90.4% V5 (many diffs) n/a
3 TRCN0000468543 TTGACTTTCGAGAACTGCCCGCTA pLX_317 100% 89.5% 90.4% V5 (many diffs) n/a
Download CSV