Transcript: Human NM_030770.4

Homo sapiens transmembrane serine protease 5 (TMPRSS5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
TMPRSS5 (80975)
Length:
2168
CDS:
85..1458

Additional Resources:

NCBI RefSeq record:
NM_030770.4
NBCI Gene record:
TMPRSS5 (80975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030770.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047076 CCTTGCAGGATGAGGAGATAA pLKO.1 332 CDS 100% 13.200 9.240 N TMPRSS5 n/a
2 TRCN0000047075 CCATACTTACAGCTCGGATAT pLKO.1 1143 CDS 100% 10.800 7.560 N TMPRSS5 n/a
3 TRCN0000047074 GCACTTCTGGTCAAGTTGTTT pLKO.1 671 CDS 100% 5.625 3.938 N TMPRSS5 n/a
4 TRCN0000047077 GTCAAGTTGTTTCCCTCAGAT pLKO.1 680 CDS 100% 4.950 3.465 N TMPRSS5 n/a
5 TRCN0000047073 CCCTGATTTCAGAGTCCTCTT pLKO.1 1646 3UTR 100% 4.050 2.835 N TMPRSS5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030770.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12714 pDONR223 100% 91.5% 91.9% None (many diffs) n/a
2 ccsbBroad304_12714 pLX_304 0% 91.5% 91.9% V5 (many diffs) n/a
3 TRCN0000468489 TCCATTACACTCTTACTAGCCCTT pLX_317 28.8% 91.5% 91.9% V5 (many diffs) n/a
Download CSV