Transcript: Human NM_030774.4

Homo sapiens olfactory receptor family 51 subfamily E member 2 (OR51E2), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
OR51E2 (81285)
Length:
2792
CDS:
252..1214

Additional Resources:

NCBI RefSeq record:
NM_030774.4
NBCI Gene record:
OR51E2 (81285)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030774.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357855 TTTAGTGTTGTCCCTACTTTC pLKO_005 1527 3UTR 100% 10.800 15.120 N OR51E2 n/a
2 TRCN0000357852 CCTTCTATGTGCCACTTATTG pLKO_005 997 CDS 100% 13.200 10.560 N OR51E2 n/a
3 TRCN0000009413 GCCTTCTATGTGCCACTTATT pLKO.1 996 CDS 100% 13.200 10.560 N OR51E2 n/a
4 TRCN0000009411 GCCCTTAATAATAATGCCAAT pLKO.1 2191 3UTR 100% 4.050 3.240 N OR51E2 n/a
5 TRCN0000357874 ATCTACCTAAAGGACTATTAT pLKO_005 1349 3UTR 100% 15.000 10.500 N OR51E2 n/a
6 TRCN0000357854 GGTTTGATTCCCGAGAGATTA pLKO_005 505 CDS 100% 13.200 9.240 N OR51E2 n/a
7 TRCN0000009415 GCAGTGCTCAACAATACAGTA pLKO.1 648 CDS 100% 4.950 3.465 N OR51E2 n/a
8 TRCN0000009412 CCCATCATCTATGGTGCCAAA pLKO.1 1113 CDS 100% 4.050 2.835 N OR51E2 n/a
9 TRCN0000009414 CCAGGATTAGAGAAAGCCCAT pLKO.1 300 CDS 100% 2.160 1.512 N OR51E2 n/a
10 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1848 3UTR 100% 1.080 0.540 Y GPR83 n/a
11 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1848 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030774.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09060 pDONR223 100% 99.8% 100% None 777G>T n/a
2 ccsbBroad304_09060 pLX_304 0% 99.8% 100% V5 777G>T n/a
3 TRCN0000471797 TAATTTCTTGGTTCTCAACCTTCG pLX_317 45.2% 99.8% 100% V5 777G>T n/a
4 TRCN0000489165 GGCAGTTCGAACGCACTAAAATTA pLX_317 38.2% 99.7% 99.6% V5 777G>T;960_961insG n/a
5 TRCN0000489822 CTTTTACAAGCTCTGGTGAGACGT pLX_317 44.9% 99.8% 100% V5 (not translated due to prior stop codon) 777G>T n/a
Download CSV