Transcript: Human NM_031370.3

Homo sapiens heterogeneous nuclear ribonucleoprotein D (HNRNPD), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
HNRNPD (3184)
Length:
3068
CDS:
314..1381

Additional Resources:

NCBI RefSeq record:
NM_031370.3
NBCI Gene record:
HNRNPD (3184)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031370.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001292 GCGGCTAGTTCAGAGAGATTT pLKO.1 2147 3UTR 100% 13.200 18.480 N HNRNPD n/a
2 TRCN0000103737 CGGAGAGTGTAGATAAGGTCA pLKO.1 756 CDS 100% 2.640 3.696 N Hnrnpd n/a
3 TRCN0000324423 CGGAGAGTGTAGATAAGGTCA pLKO_005 756 CDS 100% 2.640 3.696 N Hnrnpd n/a
4 TRCN0000293284 ACTATGGATATGGTGATTATA pLKO_005 1290 CDS 100% 15.000 12.000 N HNRNPD n/a
5 TRCN0000293354 CCGAAATTGAGGACATGATTA pLKO_005 1821 3UTR 100% 13.200 10.560 N HNRNPD n/a
6 TRCN0000103735 CCTGAATGGAAGTATGACGTT pLKO.1 1507 3UTR 100% 2.640 2.112 N Hnrnpd n/a
7 TRCN0000324352 CCTGAATGGAAGTATGACGTT pLKO_005 1507 3UTR 100% 2.640 2.112 N Hnrnpd n/a
8 TRCN0000001296 TCGAAGGAACAATATCAGCAA pLKO.1 1088 CDS 100% 2.640 2.112 N HNRNPD n/a
9 TRCN0000293283 TCGAAGGAACAATATCAGCAA pLKO_005 1088 CDS 100% 2.640 2.112 N HNRNPD n/a
10 TRCN0000103738 CACAATGTTGGTCTTAGTAAA pLKO.1 1046 CDS 100% 13.200 9.240 N Hnrnpd n/a
11 TRCN0000324351 CACAATGTTGGTCTTAGTAAA pLKO_005 1046 CDS 100% 13.200 9.240 N Hnrnpd n/a
12 TRCN0000001295 AGGATATGACTACACTGGTTA pLKO.1 1261 CDS 100% 4.950 3.465 N HNRNPD n/a
13 TRCN0000001294 AGTAAGAACGAGGAGGATGAA pLKO.1 524 CDS 100% 4.950 3.465 N HNRNPD n/a
14 TRCN0000293352 AGTAAGAACGAGGAGGATGAA pLKO_005 524 CDS 100% 4.950 3.465 N HNRNPD n/a
15 TRCN0000103739 GAAAGATCTGAAGGACTACTT pLKO.1 643 CDS 100% 4.950 3.465 N Hnrnpd n/a
16 TRCN0000324354 GAAAGATCTGAAGGACTACTT pLKO_005 643 CDS 100% 4.950 3.465 N Hnrnpd n/a
17 TRCN0000001293 AGAGTGGTTATGGGAAGGTAT pLKO.1 1320 CDS 100% 4.950 2.970 N HNRNPD n/a
18 TRCN0000293353 AGAGTGGTTATGGGAAGGTAT pLKO_005 1320 CDS 100% 4.950 2.970 N HNRNPD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031370.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00766 pDONR223 98.6% 100% 100% None n/a
2 ccsbBroad304_00766 pLX_304 0% 100% 100% V5 (not translated due to prior stop codon) n/a
3 ccsbBroadEn_15451 pDONR223 0% 86.1% 85.9% None 854_1000del n/a
4 ccsbBroad304_15451 pLX_304 0% 86.1% 85.9% V5 854_1000del n/a
5 TRCN0000468850 CCTGTTACTTTTTATATGGGTCTG pLX_317 42.6% 86.1% 85.9% V5 854_1000del n/a
Download CSV