Transcript: Human NM_032124.5

Homo sapiens haloacid dehalogenase like hydrolase domain containing 2 (HDHD2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
HDHD2 (84064)
Length:
2185
CDS:
134..913

Additional Resources:

NCBI RefSeq record:
NM_032124.5
NBCI Gene record:
HDHD2 (84064)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032124.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296070 TTAGGCTGTAGTTCTAATATT pLKO_005 1328 3UTR 100% 15.000 21.000 N HDHD2 n/a
2 TRCN0000359312 AGGCGCACAGGAAGCTCTTAA pLKO_005 211 CDS 100% 13.200 18.480 N HDHD2 n/a
3 TRCN0000366759 AGGCGCACAGGAAGCTCTTAA pLKO_005 211 CDS 100% 13.200 18.480 N Hdhd2 n/a
4 TRCN0000050151 CCTCTGATAGCAATCCACAAA pLKO.1 548 CDS 100% 4.950 6.930 N HDHD2 n/a
5 TRCN0000288952 CCTCTGATAGCAATCCACAAA pLKO_005 548 CDS 100% 4.950 6.930 N HDHD2 n/a
6 TRCN0000050150 CTTAGTAAAGACTGGGAAATA pLKO.1 796 CDS 100% 13.200 9.240 N HDHD2 n/a
7 TRCN0000310186 TGATCGGGCACTACCTGATTT pLKO_005 418 CDS 100% 13.200 9.240 N HDHD2 n/a
8 TRCN0000359263 CACATTCTGCAGCACCTATTG pLKO_005 890 CDS 100% 10.800 7.560 N HDHD2 n/a
9 TRCN0000359262 GAATTGCGGCTAGCCAGTAAG pLKO_005 1067 3UTR 100% 10.800 7.560 N HDHD2 n/a
10 TRCN0000050149 CCTGTTAGAAAGGTTGAGAAA pLKO.1 298 CDS 100% 4.950 3.465 N HDHD2 n/a
11 TRCN0000050152 CTTTAGAGTATGCCACAGATA pLKO.1 627 CDS 100% 4.950 3.465 N HDHD2 n/a
12 TRCN0000050148 GCCAGGTATTACAAGAGGAAA pLKO.1 569 CDS 100% 4.950 3.465 N HDHD2 n/a
13 TRCN0000288953 GCCAGGTATTACAAGAGGAAA pLKO_005 569 CDS 100% 4.950 3.465 N HDHD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032124.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04322 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04322 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472455 CTCAGCTTGAGGGTTCCTGGATAC pLX_317 70.7% 100% 100% V5 n/a
4 ccsbBroadEn_12771 pDONR223 100% 65.2% 65.2% None 1_270del n/a
5 ccsbBroad304_12771 pLX_304 0% 65.2% 65.2% V5 1_270del n/a
6 TRCN0000471084 TGCTCTGTATAATTGACACACCAA pLX_317 87.6% 65.2% 65.2% V5 1_270del n/a
Download CSV