Transcript: Human NM_032796.4

Homo sapiens synapse associated protein 1 (SYAP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SYAP1 (94056)
Length:
6153
CDS:
114..1172

Additional Resources:

NCBI RefSeq record:
NM_032796.4
NBCI Gene record:
SYAP1 (94056)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032796.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167475 GAAGGCATGAAAGAGTATAAT pLKO.1 1252 3UTR 100% 15.000 10.500 N SYAP1 n/a
2 TRCN0000172252 CCTTCGATGCCTGTAACCTAA pLKO.1 949 CDS 100% 4.950 3.465 N SYAP1 n/a
3 TRCN0000168452 GCTGCTAAGCAAGATGAGATT pLKO.1 650 CDS 100% 4.950 3.465 N SYAP1 n/a
4 TRCN0000167744 GACAAGACAATTATAGGAGAT pLKO.1 402 CDS 100% 4.050 2.835 N SYAP1 n/a
5 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3838 3UTR 100% 4.950 2.475 Y CFLAR n/a
6 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3838 3UTR 100% 4.950 2.475 Y C19orf31 n/a
7 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 4422 3UTR 100% 1.080 0.540 Y GPR83 n/a
8 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 4422 3UTR 100% 1.080 0.540 Y MYORG n/a
9 TRCN0000167340 CCTACTTAATGGGTTGATTAT pLKO.1 1569 3UTR 100% 13.200 9.240 N SYAP1 n/a
10 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 5764 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1777 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2389 3UTR 100% 10.800 5.400 Y SMIM11A n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4945 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3836 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3836 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3836 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4945 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032796.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09365 pDONR223 100% 99.9% 99.7% None 77C>T n/a
2 ccsbBroad304_09365 pLX_304 0% 99.9% 99.7% V5 77C>T n/a
3 TRCN0000473312 AAATACCGCAATACTATCGAGCGC pLX_317 41.2% 99.9% 99.7% V5 77C>T n/a
Download CSV