Transcript: Human NM_032814.4

Homo sapiens ring finger protein, transmembrane 2 (RNFT2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-03
Taxon:
Homo sapiens (human)
Gene:
RNFT2 (84900)
Length:
2391
CDS:
210..1472

Additional Resources:

NCBI RefSeq record:
NM_032814.4
NBCI Gene record:
RNFT2 (84900)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032814.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005095 GCTGTACAACAGCCTCATATT pLKO.1 926 CDS 100% 13.200 18.480 N RNFT2 n/a
2 TRCN0000428933 TGACGGAACCCAGTGTATTAC pLKO_005 1573 3UTR 100% 13.200 18.480 N RNFT2 n/a
3 TRCN0000427665 CAGATGGGATGGTTTAGTTTA pLKO_005 1764 3UTR 100% 13.200 9.240 N RNFT2 n/a
4 TRCN0000417521 CCAATGGTTTCTCCAATTATG pLKO_005 1640 3UTR 100% 13.200 9.240 N RNFT2 n/a
5 TRCN0000435250 CAAACTGTGCTTTCAGCATAA pLKO_005 734 CDS 100% 10.800 7.560 N RNFT2 n/a
6 TRCN0000419897 GCAGCAACACGGATAACATTC pLKO_005 262 CDS 100% 10.800 7.560 N RNFT2 n/a
7 TRCN0000423551 TGATCTGCTGGCTCCAGAAAG pLKO_005 685 CDS 100% 10.800 7.560 N RNFT2 n/a
8 TRCN0000414993 TGGATGAAGGTGGCGTCTTTG pLKO_005 328 CDS 100% 10.800 7.560 N RNFT2 n/a
9 TRCN0000005093 CCCTCTATGTGCTTTATACAT pLKO.1 892 CDS 100% 5.625 3.938 N RNFT2 n/a
10 TRCN0000005092 GCTGTGGTACAAATACATCAT pLKO.1 1154 CDS 100% 4.950 3.465 N RNFT2 n/a
11 TRCN0000426939 AGTGCAGGTGTGTAAGGAAAT pLKO_005 1458 CDS 100% 10.800 6.480 N RNFT2 n/a
12 TRCN0000005091 CTTTATTACTTTGGGAAGTCA pLKO.1 1524 3UTR 100% 3.000 1.800 N RNFT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032814.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14319 pDONR223 100% 47.5% 35.4% None (many diffs) n/a
2 ccsbBroad304_14319 pLX_304 0% 47.5% 35.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469358 CAGATGGTATTGCAACCGCGGCCG pLX_317 54.9% 47.5% 35.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV