Transcript: Human NM_032842.4

Homo sapiens transmembrane protein 209 (TMEM209), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TMEM209 (84928)
Length:
3455
CDS:
32..1717

Additional Resources:

NCBI RefSeq record:
NM_032842.4
NBCI Gene record:
TMEM209 (84928)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032842.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115888 CCTACGAACTTTGGATACTTT pLKO.1 745 CDS 100% 5.625 7.875 N TMEM209 n/a
2 TRCN0000292136 CCTACGAACTTTGGATACTTT pLKO_005 745 CDS 100% 5.625 7.875 N TMEM209 n/a
3 TRCN0000115889 CCGACTTTGAACACAATCGTT pLKO.1 1205 CDS 100% 3.000 4.200 N TMEM209 n/a
4 TRCN0000307961 CCGACTTTGAACACAATCGTT pLKO_005 1205 CDS 100% 3.000 4.200 N TMEM209 n/a
5 TRCN0000115887 GCTTCCATCATCTTATGTAAA pLKO.1 2918 3UTR 100% 13.200 10.560 N TMEM209 n/a
6 TRCN0000292138 GCTTCCATCATCTTATGTAAA pLKO_005 2918 3UTR 100% 13.200 10.560 N TMEM209 n/a
7 TRCN0000115890 GCATCTCTCTTCAGCCTTAAT pLKO.1 242 CDS 100% 13.200 9.240 N TMEM209 n/a
8 TRCN0000307960 GCATCTCTCTTCAGCCTTAAT pLKO_005 242 CDS 100% 13.200 9.240 N TMEM209 n/a
9 TRCN0000115891 CCAGATGTTACAAATGAGAAT pLKO.1 1487 CDS 100% 4.950 3.465 N TMEM209 n/a
10 TRCN0000292137 CCAGATGTTACAAATGAGAAT pLKO_005 1487 CDS 100% 4.950 3.465 N TMEM209 n/a
11 TRCN0000183287 GCTGGAATGATATATACTGAA pLKO.1 149 CDS 100% 4.950 3.465 N Tmem209 n/a
12 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2277 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032842.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12883 pDONR223 100% 92.3% 92.1% None 1119_1244del;1406C>G;1514A>G n/a
2 ccsbBroad304_12883 pLX_304 0% 92.3% 92.1% V5 1119_1244del;1406C>G;1514A>G n/a
3 TRCN0000479999 TGCCCGCCCAAAGGTGGAGGATCC pLX_317 27.9% 92.3% 92.1% V5 1119_1244del;1406C>G;1514A>G n/a
Download CSV