Transcript: Human NM_033303.4

Homo sapiens adrenoceptor alpha 1A (ADRA1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ADRA1A (148)
Length:
2554
CDS:
687..2114

Additional Resources:

NCBI RefSeq record:
NM_033303.4
NBCI Gene record:
ADRA1A (148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033303.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356608 GGCGTTTGTGAATGGAAATTT pLKO_005 1863 CDS 100% 15.000 10.500 N ADRA1A n/a
2 TRCN0000356606 CTTGCTCAGAAGCTCAATATG pLKO_005 2302 3UTR 100% 13.200 9.240 N ADRA1A n/a
3 TRCN0000356666 GTCATGCCCATTGGGTCTTTC pLKO_005 1557 CDS 100% 10.800 7.560 N ADRA1A n/a
4 TRCN0000008053 CCTGATTTCAAGCCCTCTGAA pLKO.1 1581 CDS 100% 4.950 3.465 N ADRA1A n/a
5 TRCN0000008051 GCAATCCTTTCTGTGGATGAA pLKO.1 2279 3UTR 100% 4.950 3.465 N ADRA1A n/a
6 TRCN0000008052 GCCAGGATTACAGTGTCCAAA pLKO.1 1908 CDS 100% 4.950 3.465 N ADRA1A n/a
7 TRCN0000356607 GTGGATCTGCCAGGATTACAG pLKO_005 1900 CDS 100% 4.950 3.465 N ADRA1A n/a
8 TRCN0000008055 CACGCACTACTACATCGTCAA pLKO.1 866 CDS 100% 4.050 2.835 N ADRA1A n/a
9 TRCN0000008054 CCTTTCAGAATGTCTTGAGAA pLKO.1 1693 CDS 100% 4.950 2.970 N ADRA1A n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2203 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2203 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033303.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488275 GGCTAGGCGGACTGTCGTCCAAGA pLX_317 18.2% 91.4% 88.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV