Transcript: Human NM_033507.3

Homo sapiens glucokinase (GCK), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GCK (2645)
Length:
2424
CDS:
163..1563

Additional Resources:

NCBI RefSeq record:
NM_033507.3
NBCI Gene record:
GCK (2645)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033507.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010267 CGACCGCAAGCAGATCTACAA pLKO.1 1194 CDS 100% 4.950 6.930 N GCK n/a
2 TRCN0000010269 CGAGACGCTATCAAACGGAGA pLKO.1 721 CDS 100% 2.160 3.024 N GCK n/a
3 TRCN0000199353 CGAGGACGTAATGCGCATCAC pLKO.1 1359 CDS 100% 1.350 1.890 N GCK n/a
4 TRCN0000199719 GCCTTGACTCTGGTAGAGCAG pLKO.1 199 CDS 100% 0.720 1.008 N GCK n/a
5 TRCN0000194703 CCTTTCTCGCTGGAATCAATT pLKO.1 1809 3UTR 100% 13.200 9.240 N GCK n/a
6 TRCN0000195021 CTCAGGACTTTGATGCATTTC pLKO.1 1850 3UTR 100% 10.800 7.560 N GCK n/a
7 TRCN0000195412 CCTGGACAAGCATCAGATGAA pLKO.1 564 CDS 100% 4.950 3.465 N GCK n/a
8 TRCN0000197004 GAAGCTCATAGGTGGCAAGTA pLKO.1 1035 CDS 100% 4.950 3.465 N GCK n/a
9 TRCN0000012400 GCATCAGATGAAACACAAGAA pLKO.1 573 CDS 100% 4.950 3.465 N Gck n/a
10 TRCN0000010268 GCTCTTCGACTACATCTCTGA pLKO.1 528 CDS 100% 2.640 1.848 N GCK n/a
11 TRCN0000199354 CGTGGATGGCTCCGTGTACAA pLKO.1 1386 CDS 100% 1.650 1.155 N GCK n/a
12 TRCN0000010270 CTACGAAGACCATCAGTGCGA pLKO.1 807 CDS 100% 0.660 0.462 N GCK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033507.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00624 pDONR223 100% 97.7% 97.4% None (many diffs) n/a
2 ccsbBroad304_00624 pLX_304 0% 97.7% 97.4% V5 (many diffs) n/a
3 TRCN0000468306 GCGATAACTTATGCTACTCCATAT pLX_317 31.6% 97.7% 97.4% V5 (many diffs) n/a
4 ccsbBroadEn_14654 pDONR223 0% 97.7% 97.4% None (many diffs) n/a
5 ccsbBroad304_14654 pLX_304 0% 97.7% 97.4% V5 (many diffs) n/a
6 TRCN0000480104 TCCTATTCACCTTTCACATAAAAC pLX_317 25.5% 97.7% 97.4% V5 (many diffs) n/a
7 TRCN0000489651 ACAGAGTAGCGGTATCCGCCCAAT pLX_317 25.1% 97.7% 97.4% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489668 TGCTACGCCATCCATTGTTCTGGC pLX_317 24.9% 97.7% 97.4% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489255 TCACTGTGAAGAAGTACTGAATTT pLX_317 28.6% 97.7% 97.2% V5 (many diffs) n/a
Download CSV