Transcript: Mouse NM_033523.4

Mus musculus sprouty-related, EVH1 domain containing 2 (Spred2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Spred2 (114716)
Length:
2872
CDS:
490..1722

Additional Resources:

NCBI RefSeq record:
NM_033523.4
NBCI Gene record:
Spred2 (114716)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033523.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066277 GCTACGGACAGTTCTTCTAAT pLKO.1 931 CDS 100% 13.200 18.480 N Spred2 n/a
2 TRCN0000303154 GCTACGGACAGTTCTTCTAAT pLKO_005 931 CDS 100% 13.200 18.480 N Spred2 n/a
3 TRCN0000056830 CAGCTATATTGTGCGTGTCAA pLKO.1 519 CDS 100% 4.950 6.930 N SPRED2 n/a
4 TRCN0000066273 CCCAAACACGAATATACCTAT pLKO.1 1252 CDS 100% 4.950 3.465 N Spred2 n/a
5 TRCN0000066275 GAAGGTTGATAACAGGAAGTT pLKO.1 762 CDS 100% 4.950 3.465 N Spred2 n/a
6 TRCN0000303152 GAAGGTTGATAACAGGAAGTT pLKO_005 762 CDS 100% 4.950 3.465 N Spred2 n/a
7 TRCN0000066274 GAGACTACACTGACCCTTGTT pLKO.1 1541 CDS 100% 4.950 3.465 N Spred2 n/a
8 TRCN0000303226 GAGACTACACTGACCCTTGTT pLKO_005 1541 CDS 100% 4.950 3.465 N Spred2 n/a
9 TRCN0000066276 AGGGATATGTTTAATCACGAA pLKO.1 1402 CDS 100% 2.640 1.848 N Spred2 n/a
10 TRCN0000303153 AGGGATATGTTTAATCACGAA pLKO_005 1402 CDS 100% 2.640 1.848 N Spred2 n/a
11 TRCN0000056829 AGAAAGACAAACTGGTGGTAT pLKO.1 680 CDS 100% 4.950 2.970 N SPRED2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033523.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476321 CTGGATCGCTCCCCTCCTTGCGCC pLX_317 30.4% 86.6% 92.3% V5 (many diffs) n/a
2 ccsbBroadEn_05192 pDONR223 100% 86.5% 92.1% None (many diffs) n/a
3 ccsbBroad304_05192 pLX_304 0% 86.5% 92.1% V5 (many diffs) n/a
Download CSV