Transcript: Human NM_052888.3

Homo sapiens leucine rich repeat containing 37B (LRRC37B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-14
Taxon:
Homo sapiens (human)
Gene:
LRRC37B (114659)
Length:
3042
CDS:
40..2883

Additional Resources:

NCBI RefSeq record:
NM_052888.3
NBCI Gene record:
LRRC37B (114659)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052888.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422405 GCTTCTCAACCGGGATCAGAA pLKO_005 447 CDS 100% 4.950 6.930 N LRRC37B n/a
2 TRCN0000163741 GCTGCACATCAGGACTTAAAT pLKO.1 385 CDS 100% 15.000 10.500 N LRRC37B n/a
3 TRCN0000162024 GTCCACCTACAAAGTTAGAAT pLKO.1 1508 CDS 100% 5.625 3.938 N LRRC37B n/a
4 TRCN0000162629 CACATCACACTTACAACACTT pLKO.1 2104 CDS 100% 4.950 3.465 N LRRC37B n/a
5 TRCN0000163762 GATGAGACTCTGTCATGTGTT pLKO.1 1621 CDS 100% 4.950 3.465 N LRRC37B n/a
6 TRCN0000426733 GGCAACTATTGTCTTTACTAG pLKO_005 83 CDS 100% 4.950 3.465 N LRRC37B n/a
7 TRCN0000159683 GCAATATCTGTGACTGTAATA pLKO.1 2764 CDS 100% 13.200 7.920 N LRRC37B n/a
8 TRCN0000160050 CAACTTAATTCTCAATCGCAA pLKO.1 2010 CDS 100% 2.640 1.584 N LRRC37B n/a
9 TRCN0000136505 CGAGGATGTGAGAAAGTTCAT pLKO.1 2475 CDS 100% 4.950 2.475 Y LRRC37BP1 n/a
10 TRCN0000161279 GAATGAACAGAAAGAGCAGAA pLKO.1 2685 CDS 100% 4.050 2.025 Y LRRC37B n/a
11 TRCN0000165790 CAGAGGTTAAACCGTCTCCAA pLKO.1 1331 CDS 100% 2.640 1.320 Y LRRC37B n/a
12 TRCN0000134526 GCATTGAATGTAGAATGGGAT pLKO.1 2620 CDS 100% 2.640 1.320 Y LRRC37BP1 n/a
13 TRCN0000142354 GCAGATGTGGAGGTTACCATA pLKO.1 1075 CDS 100% 4.950 2.475 Y LRRC37A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052888.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13034 pDONR223 100% 94.6% 94.6% None 1822_1974del n/a
2 ccsbBroad304_13034 pLX_304 0% 94.6% 94.6% V5 1822_1974del n/a
3 TRCN0000466676 ACGATCGTGATATACAATGGCACG pLX_317 15.7% 94.6% 94.6% V5 1822_1974del n/a
4 ccsbBroadEn_13237 pDONR223 100% 17.6% 16% None (many diffs) n/a
5 ccsbBroad304_13237 pLX_304 0% 17.6% 16% V5 (many diffs) n/a
6 TRCN0000467884 ACCCGCGACTCCAGGATTGTGATT pLX_317 53.8% 17.6% 16% V5 (many diffs) n/a
Download CSV