Transcript: Mouse NM_053075.3

Mus musculus Ras homolog enriched in brain (Rheb), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Rheb (19744)
Length:
1521
CDS:
126..680

Additional Resources:

NCBI RefSeq record:
NM_053075.3
NBCI Gene record:
Rheb (19744)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053075.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075605 CAGACATACTCCATAGATATT pLKO.1 339 CDS 100% 13.200 9.240 N Rheb n/a
2 TRCN0000075604 CAGTTTGTTGAAGGCCAATTT pLKO.1 198 CDS 100% 13.200 9.240 N Rheb n/a
3 TRCN0000075603 CCCGTCATCCTTGAAGATAAA pLKO.1 740 3UTR 100% 13.200 9.240 N Rheb n/a
4 TRCN0000010424 CCTCAGACATACTCCATAGAT pLKO.1 336 CDS 100% 5.625 3.938 N RHEB n/a
5 TRCN0000075606 CAGCTTCACAAGGAAAGTCTT pLKO.1 643 CDS 100% 4.950 3.465 N Rheb n/a
6 TRCN0000075607 GCAGATACCTATTATGTTGGT pLKO.1 455 CDS 100% 2.640 1.848 N Rheb n/a
7 TRCN0000039601 CCTACGATCCAACCATAGAAA pLKO.1 226 CDS 100% 5.625 7.875 N RHEB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053075.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01398 pDONR223 100% 92.5% 98.9% None (many diffs) n/a
2 ccsbBroad304_01398 pLX_304 98.4% 92.5% 98.9% V5 (many diffs) n/a
3 TRCN0000468386 ATTCCCATCTACATCCAGAAAAAC pLX_317 61.3% 92.5% 98.9% V5 (many diffs) n/a
4 ccsbBroadEn_06864 pDONR223 100% 92.3% 98.3% None (many diffs) n/a
5 ccsbBroad304_06864 pLX_304 98.4% 92.3% 98.3% V5 (many diffs) n/a
6 TRCN0000475474 AGGTGTTTCACCGGGTTTCGAGCT pLX_317 49.6% 92.3% 98.3% V5 (many diffs) n/a
Download CSV