Transcript: Mouse NM_053122.4

Mus musculus IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) (Immp2l), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Immp2l (93757)
Length:
1163
CDS:
132..659

Additional Resources:

NCBI RefSeq record:
NM_053122.4
NBCI Gene record:
Immp2l (93757)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053122.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296731 ACCCAGAACAGAAGATCATTA pLKO_005 382 CDS 100% 13.200 18.480 N IMMP2L n/a
2 TRCN0000221988 GCAGCAAAGATGATTTGTCTT pLKO.1 982 3UTR 100% 4.950 3.960 N Immp2l n/a
3 TRCN0000221991 CACTCCAGACTGGTGAGAAAT pLKO.1 637 CDS 100% 13.200 9.240 N Immp2l n/a
4 TRCN0000221992 GCTCTTGAAGGAGATATTGTA pLKO.1 414 CDS 100% 5.625 3.938 N Immp2l n/a
5 TRCN0000221989 GCGATCATCATGGACACAGTT pLKO.1 496 CDS 100% 4.950 3.465 N Immp2l n/a
6 TRCN0000221990 GCGTGGTGACATTGTGTCATT pLKO.1 347 CDS 100% 4.950 3.465 N Immp2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053122.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12764 pDONR223 100% 54.6% 55.4% None (many diffs) n/a
2 ccsbBroad304_12764 pLX_304 0% 54.6% 55.4% V5 (many diffs) n/a
3 TRCN0000468009 ATAAATATGGCGTGATTGGTGGTA pLX_317 100% 54.6% 55.4% V5 (many diffs) n/a
Download CSV