Transcript: Mouse NM_053208.4

Mus musculus egl-9 family hypoxia-inducible factor 2 (Egln2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Egln2 (112406)
Length:
2124
CDS:
350..1609

Additional Resources:

NCBI RefSeq record:
NM_053208.4
NBCI Gene record:
Egln2 (112406)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053208.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273706 AGGTGTTCAAGTACCAGTATC pLKO_005 1567 CDS 100% 10.800 15.120 N Egln2 n/a
2 TRCN0000009744 CGTTGAGTGTAGAGCTGAGAA pLKO.1 1845 3UTR 100% 4.950 6.930 N Egln2 n/a
3 TRCN0000284925 CGTTGAGTGTAGAGCTGAGAA pLKO_005 1845 3UTR 100% 4.950 6.930 N Egln2 n/a
4 TRCN0000022326 GCCACTCTTTGACCGGTTGCT pLKO.1 1408 CDS 100% 0.880 1.232 N EGLN2 n/a
5 TRCN0000318601 GCCACTCTTTGACCGGTTGCT pLKO_005 1408 CDS 100% 0.880 1.232 N EGLN2 n/a
6 TRCN0000009745 CTGGGCAACTACGTCATCAAT pLKO.1 1196 CDS 100% 5.625 3.938 N Egln2 n/a
7 TRCN0000009747 GCCAACATCGAGCCACTCTTT pLKO.1 1397 CDS 100% 4.950 3.465 N Egln2 n/a
8 TRCN0000273754 GCCAACATCGAGCCACTCTTT pLKO_005 1397 CDS 100% 4.950 3.465 N Egln2 n/a
9 TRCN0000009748 CCCTGGACTATATTGTGCCTT pLKO.1 918 CDS 100% 2.640 1.848 N Egln2 n/a
10 TRCN0000009746 GAATCAGAACTGGGATGTTAA pLKO.1 1327 CDS 100% 13.200 7.920 N Egln2 n/a
11 TRCN0000273016 GAATCAGAACTGGGATGTTAA pLKO_005 1327 CDS 100% 13.200 7.920 N Egln2 n/a
12 TRCN0000022325 GCTGCATCACCTGTATCTATT pLKO.1 1302 CDS 100% 13.200 7.920 N EGLN2 n/a
13 TRCN0000318672 GCTGCATCACCTGTATCTATT pLKO_005 1302 CDS 100% 13.200 7.920 N EGLN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053208.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14348 pDONR223 100% 28.1% 29.1% None (many diffs) n/a
2 ccsbBroad304_14348 pLX_304 0% 28.1% 29.1% V5 (many diffs) n/a
3 TRCN0000472254 GTTTATTACAACGAGACATCGATC pLX_317 90.6% 28.1% 29.1% V5 (many diffs) n/a
Download CSV