Transcript: Mouse NM_080462.2

Mus musculus histamine N-methyltransferase (Hnmt), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Hnmt (140483)
Length:
1653
CDS:
71..958

Additional Resources:

NCBI RefSeq record:
NM_080462.2
NBCI Gene record:
Hnmt (140483)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080462.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097605 CCGGGCATAATAGCAAGGATT pLKO.1 191 CDS 100% 4.950 6.930 N Hnmt n/a
2 TRCN0000097607 CCCAGGAATCTGTATTAACAA pLKO.1 304 CDS 100% 5.625 3.938 N Hnmt n/a
3 TRCN0000097606 GCCTGAATTTAGTGTTAAGAA pLKO.1 877 CDS 100% 5.625 3.938 N Hnmt n/a
4 TRCN0000097608 CCATGGACATAACAGACTGTT pLKO.1 741 CDS 100% 4.950 3.465 N Hnmt n/a
5 TRCN0000097604 GCCGATGTTCAGTGTGGAATA pLKO.1 1466 3UTR 100% 10.800 6.480 N Hnmt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080462.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06386 pDONR223 100% 86.2% 82.7% None (many diffs) n/a
2 ccsbBroad304_06386 pLX_304 0% 86.2% 82.7% V5 (many diffs) n/a
3 TRCN0000473124 TTGAGCATGCCAGGCCTTCGGCCT pLX_317 46.6% 86.2% 82.7% V5 (many diffs) n/a
4 ccsbBroadEn_15448 pDONR223 0% 15.1% 13.8% None (many diffs) n/a
5 ccsbBroad304_15448 pLX_304 0% 15.1% 13.8% V5 (many diffs) n/a
6 TRCN0000473500 ATTCCCCAGCCCCATTGAGTCACT pLX_317 100% 15.1% 13.8% V5 (many diffs) n/a
Download CSV