Transcript: Mouse NM_080470.1

Mus musculus structural maintenance of chromosomes 1B (Smc1b), mRNA.

Source:
NCBI, updated 2017-04-30
Taxon:
Mus musculus (mouse)
Gene:
Smc1b (140557)
Length:
4056
CDS:
21..3767

Additional Resources:

NCBI RefSeq record:
NM_080470.1
NBCI Gene record:
Smc1b (140557)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414679 GAACCAATACACGACTCAAAT pLKO_005 2140 CDS 100% 13.200 18.480 N Smc1b n/a
2 TRCN0000109049 GCTGAAGAAGATGCACAATTT pLKO.1 552 CDS 100% 13.200 9.240 N Smc1b n/a
3 TRCN0000426380 TAAGATGATGATCGATGTTAT pLKO_005 1793 CDS 100% 13.200 9.240 N Smc1b n/a
4 TRCN0000109047 GCTCCATTCTTTGTATTAGAT pLKO.1 3453 CDS 100% 5.625 3.938 N Smc1b n/a
5 TRCN0000109046 CCATTGTTGTAGCCTCAGAAA pLKO.1 1651 CDS 100% 4.950 3.465 N Smc1b n/a
6 TRCN0000109048 GCCTCAGTACATTAAGGCTAA pLKO.1 905 CDS 100% 4.050 2.835 N Smc1b n/a
7 TRCN0000109045 CCAGTCTCTGTTTAGACCCAT pLKO.1 3833 3UTR 100% 2.640 1.584 N Smc1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11845 pDONR223 100% 79.5% 76.5% None (many diffs) n/a
2 ccsbBroad304_11845 pLX_304 0% 79.5% 76.5% V5 (many diffs) n/a
3 TRCN0000480860 GTTGGACTCTATGCTTACAGCAAG pLX_317 12% 79.5% 76.5% V5 (many diffs) n/a
Download CSV