Transcript: Human NM_080760.5

Homo sapiens dachshund family transcription factor 1 (DACH1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
DACH1 (1602)
Length:
4796
CDS:
424..2100

Additional Resources:

NCBI RefSeq record:
NM_080760.5
NBCI Gene record:
DACH1 (1602)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080760.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118088 GCACTTGAGTTTGAGACGAAA pLKO.1 1906 CDS 100% 4.950 6.930 N DACH1 n/a
2 TRCN0000287040 GCACTTGAGTTTGAGACGAAA pLKO_005 1906 CDS 100% 4.950 6.930 N DACH1 n/a
3 TRCN0000294327 AGATAGTCTCAGGGTCTTAAA pLKO_005 1971 CDS 100% 13.200 10.560 N DACH1 n/a
4 TRCN0000294326 CAATTGTATACAGAGTTAAAG pLKO_005 2370 3UTR 100% 13.200 9.240 N DACH1 n/a
5 TRCN0000118087 CCTGTTTGTTATGTGGATTAA pLKO.1 4148 3UTR 100% 13.200 9.240 N DACH1 n/a
6 TRCN0000294328 TCATGTCTCCTGGGATAATTC pLKO_005 1358 CDS 100% 13.200 9.240 N DACH1 n/a
7 TRCN0000118089 CTGTTGAAAGTTGCCATAGAT pLKO.1 1705 CDS 100% 5.625 3.938 N DACH1 n/a
8 TRCN0000287041 CTGTTGAAAGTTGCCATAGAT pLKO_005 1705 CDS 100% 5.625 3.938 N DACH1 n/a
9 TRCN0000085973 CCCAGAGAACTCTCACATCAT pLKO.1 1317 CDS 100% 4.950 3.465 N Dach1 n/a
10 TRCN0000085975 GAGCAACTATCATGCCAGTAA pLKO.1 1479 CDS 100% 4.950 3.465 N Dach1 n/a
11 TRCN0000118091 GCTGTTGAAAGTTGCCATAGA pLKO.1 1704 CDS 100% 4.950 3.465 N DACH1 n/a
12 TRCN0000118090 ACTCTCACATCATGCCGCATT pLKO.1 1325 CDS 100% 4.050 2.835 N DACH1 n/a
13 TRCN0000085976 CCTCTACAATGACTGCACCAA pLKO.1 1245 CDS 100% 2.640 1.848 N Dach1 n/a
14 TRCN0000424048 ACTACTGTCATGTACTGAATA pLKO_005 2083 CDS 100% 13.200 9.240 N Dach1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080760.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13842 pDONR223 100% 52.2% 3% None 1_567del;580_581insG;1125_1126ins444 n/a
2 ccsbBroad304_13842 pLX_304 0% 52.2% 3% V5 (not translated due to prior stop codon) 1_567del;580_581insG;1125_1126ins444 n/a
3 TRCN0000474576 CCGCATCAATTTCGCCTCTGTCTC pLX_317 17.9% 52.2% 3% V5 (not translated due to prior stop codon) 1_567del;580_581insG;1125_1126ins444 n/a
Download CSV